Transcript: Mouse NM_001286049.1

Mus musculus ectonucleoside triphosphate diphosphohydrolase 5 (Entpd5), transcript variant 3, mRNA.

Source:
NCBI, updated 2017-06-03
Taxon:
Mus musculus (mouse)
Gene:
Entpd5 (12499)
Length:
4962
CDS:
245..1528

Additional Resources:

NCBI RefSeq record:
NM_001286049.1
NBCI Gene record:
Entpd5 (12499)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001286049.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000080773 CCCTGCTGAATTTGGCTATTT pLKO.1 2731 3UTR 100% 13.200 18.480 N Entpd5 n/a
2 TRCN0000050480 GCTCTATACACATAGTTACTT pLKO.1 949 CDS 100% 5.625 7.875 N ENTPD5 n/a
3 TRCN0000080775 GTCCACATCTTGGGAAGAATA pLKO.1 225 5UTR 100% 13.200 9.240 N Entpd5 n/a
4 TRCN0000327166 GTCCACATCTTGGGAAGAATA pLKO_005 225 5UTR 100% 13.200 9.240 N Entpd5 n/a
5 TRCN0000080776 CGCCTTCTACGCTTTCTCTTA pLKO.1 1213 CDS 100% 4.950 3.465 N Entpd5 n/a
6 TRCN0000354170 CGCCTTCTACGCTTTCTCTTA pLKO_005 1213 CDS 100% 4.950 3.465 N Entpd5 n/a
7 TRCN0000080777 GATGGGTCCTATGAAGGCATA pLKO.1 743 CDS 100% 4.050 2.835 N Entpd5 n/a
8 TRCN0000327095 GATGGGTCCTATGAAGGCATA pLKO_005 743 CDS 100% 4.050 2.835 N Entpd5 n/a
9 TRCN0000229315 TCACTTCCTTTGAGATGTTTA pLKO_005 915 CDS 100% 13.200 7.920 N ENTPD5 n/a
10 TRCN0000080774 GCTCACAAAGAAAGTGAACAA pLKO.1 1441 CDS 100% 4.950 2.970 N Entpd5 n/a
11 TRCN0000327094 GCTCACAAAGAAAGTGAACAA pLKO_005 1441 CDS 100% 4.950 2.970 N Entpd5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286049.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15379 pDONR223 0% 87.2% 88% None (many diffs) n/a
2 ccsbBroad304_15379 pLX_304 0% 87.2% 88% V5 (many diffs) n/a
3 ccsbBroadEn_13825 pDONR223 100% 81.9% 81.8% None (many diffs) n/a
4 ccsbBroad304_13825 pLX_304 0% 81.9% 81.8% V5 (many diffs) n/a
5 TRCN0000472576 CTGATAGGACTATTAAGCTCCGCA pLX_317 31.2% 81.9% 81.8% V5 (many diffs) n/a
Download CSV