Construct: ORF TRCN0000472622
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF018020.1_s317c1
- Derived from:
- ccsbBroadEn_00850
- DNA Barcode:
- CGTTGCGCAAGTCCCGGGCGTCAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IL6R (3570)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472622
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 3570 | IL6R | interleukin 6 receptor | NM_000565.4 | 100% | 100% | |
| 2 | human | 3570 | IL6R | interleukin 6 receptor | XM_006711298.2 | 96.6% | 96.6% | 948_995del |
| 3 | human | 3570 | IL6R | interleukin 6 receptor | XM_017001200.2 | 93.4% | 93.2% | 1067_1165del |
| 4 | human | 3570 | IL6R | interleukin 6 receptor | XM_017001199.2 | 90.5% | 90.3% | 948_995del;1115_1213del |
| 5 | human | 3570 | IL6R | interleukin 6 receptor | NM_181359.3 | 77.9% | 76.1% | 1064_1065ins94;1095_1096ins215 |
| 6 | human | 3570 | IL6R | interleukin 6 receptor | XM_005245139.2 | 76.9% | 59.1% | 806_807ins142;922_923ins94;1080_1081ins88 |
| 7 | human | 3570 | IL6R | interleukin 6 receptor | XM_006711299.4 | 75.4% | 73.6% | 948_995del;1112_1113ins94;1143_1144ins215 |
| 8 | human | 3570 | IL6R | interleukin 6 receptor | NM_001206866.1 | 72.6% | 69% | (many diffs) |
| 9 | human | 3570 | IL6R | interleukin 6 receptor | XM_005245140.3 | 72.2% | 56.3% | 806_807ins142;1014_1015ins248 |
| 10 | human | 3570 | IL6R | interleukin 6 receptor | XM_017001201.2 | 67.4% | 55.4% | 806_807ins142;925_1023del;1113_1114ins248 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1473
- ORF length:
- 1404
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gctggccgtc ggctgcgcgc tgctggctgc cctgctggcc gcgccgggag 121 cggcgctggc cccaaggcgc tgccctgcgc aggaggtggc gagaggcgtg ctgaccagtc 181 tgccaggaga cagcgtgact ctgacctgcc cgggggtaga gccggaagac aatgccactg 241 ttcactgggt gctcaggaag ccggctgcag gctcccaccc cagcagatgg gctggcatgg 301 gaaggaggct gctgctgagg tcggtgcagc tccacgactc tggaaactat tcatgctacc 361 gggccggccg cccagctggg actgtgcact tgctggtgga tgttcccccc gaggagcccc 421 agctctcctg cttccggaag agccccctca gcaatgttgt ttgtgagtgg ggtcctcgga 481 gcaccccatc cctgacgaca aaggctgtgc tcttggtgag gaagtttcag aacagtccgg 541 ccgaagactt ccaggagccg tgccagtatt cccaggagtc ccagaagttc tcctgccagt 601 tagcagtccc ggagggagac agctctttct acatagtgtc catgtgcgtc gccagtagtg 661 tcgggagcaa gttcagcaaa actcaaacct ttcagggttg tggaatcttg cagcctgatc 721 cgcctgccaa catcacagtc actgccgtgg ccagaaaccc ccgctggctc agtgtcacct 781 ggcaagaccc ccactcctgg aactcatctt tctacagact acggtttgag ctcagatatc 841 gggctgaacg gtcaaagaca ttcacaacat ggatggtcaa ggacctccag catcactgtg 901 tcatccacga cgcctggagc ggcctgaggc acgtggtgca gcttcgtgcc caggaggagt 961 tcgggcaagg cgagtggagc gagtggagcc cggaggccat gggcacgcct tggacagaat 1021 ccaggagtcc TCCAGCTGAG AACGAGGTGT CCACCCCCAT GCAGGCACTT ACTACTAATA 1081 AAGACGATGA TAATATTCTC TTCAGAGATT CTGCAAATGC GACAAGCCTC CCAGTGCAAG 1141 ATTCTTCTTC AGTACCACTG CCCACATTCC TGGTTGCTGG AGGGAGCCTG GCCTTCGGAA 1201 CGCTCCTCTG CATTGCCATT GTTCTGAGGT TCAAGAAGAC GTGGAAGCTG CGGGCTCTGA 1261 AGGAAGGCAA GACAAGCATG CATCCGCCGT ACTCTTTGGG GCAGCTGGTC CCGGAGAGGC 1321 CTCGACCCAC CCCAGTGCTT GTTCCTCTCA TCTCCCCACC GGTGTCCCCC AGCAGCCTGG 1381 GGTCTGACAA TACCTCGAGC CACAACCGAC CAGATGCCAG GGACCCACGG AGCCCTTATG 1441 ACATCAGCAA TACAGACTAC TTCTTCCCCA GATTGCCAAC TTTCTTGTAC AAAGTGGTTG 1501 ATATCGGTAA GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA 1561 GTCCGTAACT TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGACG 1621 TTGCGCAAGT CCCGGGCGTC ATACGCGTTA AGTCgacaat caacctctgg attacaaaat 1681 ttgtgaaaga tt