Construct: ORF TRCN0000472644
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF010619.1_s317c1
- Derived from:
- ccsbBroadEn_10742
- DNA Barcode:
- AAATACACGTGAACGCGAAATTCG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- COL9A1 (1297)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472644
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 1297 | COL9A1 | collagen type IX alpha 1 chain | NM_001851.5 | 35.5% | 35.5% | (many diffs) |
2 | human | 1297 | COL9A1 | collagen type IX alpha 1 chain | XM_011535429.3 | 35.1% | 35.1% | (many diffs) |
3 | human | 1297 | COL9A1 | collagen type IX alpha 1 chain | XM_017010246.2 | 15.4% | 15.4% | (many diffs) |
4 | mouse | 12839 | Col9a1 | collagen, type IX, alpha 1 | XM_006495649.3 | 60% | 61.2% | (many diffs) |
5 | mouse | 12839 | Col9a1 | collagen, type IX, alpha 1 | NM_007740.3 | 30.4% | 31% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1050
- ORF length:
- 984
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa gacctgctgg aaaattccag ttttcttctt tgtgtgcagt ttcctggaac 121 cctgggcatc tgcagctgtc aagcgtcgcc ccagattccc tgtcaattcc aattctaatg 181 gtggaaatga actctgtcca aagatcagga ttggccaaga tgacttacca gggtttgatc 241 tgatctctca gttccaggta gataaagcag catctagaag agctatccag agagtagtgg 301 gatcagctac attgcaggtg gcttacaagt tgggaaataa tgtagacttc aggattccaa 361 ctaggaattt atatcccagt ggactgcctg aagaatactc cttcttgacg acgtttcgaa 421 tgactggaag cactctcaaa aagaactgga acatttggca gattcaggat tcctctggga 481 aggagcaagt tggcataaag attaatggcc aaacacaatc tgttgtattt tcatacaagg 541 gactggatgg aagtctccaa acagcagcct tttcgaattt gtcctccttg tttgattccc 601 agtggcataa gatcatgatt GGCGTGGAGA GGAGTAGTGC TACTCTTTTT GTTGACTGCA 661 ACAGGATTGA ATCTTTACCT ATAAAGCCAA GAGGCCCAAT TGACATTGAT GGCTTTGCTG 721 TGCTGGGAAA ACTTGCAGAT AATCCTCAAG TTTCTGTTCC ATTTGAACTT CAATGGATGC 781 TGATCCATTG TGACCCCCTG CGGCCCAGGA GAGAAACTTG CCATGAGCTG CCAGCCAGAA 841 TAACGCCCAG CCAGACCACC GACGAGAGAG GTCCCCCGGG TGAGCAGGGT CCTCCCGGGC 901 CTCCGGGCCC CCCTGGAGTT CCAGGCATCG ATGGCATCGA CGGTGACCGA GGTCCTAAGG 961 GCCCCCCGGG CCCCCCGGGT CCTGCAGGTG AACCGGGAAA GCCAGGAGCT CCAGGCAAGC 1021 CTGGCACACC TGGCGCTGAT ACCAGTCCTT GCCCAACTTT CTTGTACAAA GTGGTTGATA 1081 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1141 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAAAATA 1201 CACGTGAACG CGAAATTCGA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1261 tgaaagatt