Transcript: Human NM_001851.5

Homo sapiens collagen type IX alpha 1 chain (COL9A1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-22
Taxon:
Homo sapiens (human)
Gene:
COL9A1 (1297)
Length:
4762
CDS:
161..2926

Additional Resources:

NCBI RefSeq record:
NM_001851.5
NBCI Gene record:
COL9A1 (1297)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001851.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000083365 GCAGGTTTGCATGAGAGTCAT pLKO.1 2449 CDS 100% 4.950 6.930 N COL9A1 n/a
2 TRCN0000371969 CCTCAGTTGCAGTAGTTATTT pLKO_005 3296 3UTR 100% 15.000 10.500 N COL9A1 n/a
3 TRCN0000083366 GCTTACAAGTTGGGAAATAAT pLKO.1 416 CDS 100% 15.000 10.500 N COL9A1 n/a
4 TRCN0000083364 CCTGTCAATTCCAATTCTAAT pLKO.1 254 CDS 100% 13.200 9.240 N COL9A1 n/a
5 TRCN0000371971 GTATTACCTTCAGTATGATTA pLKO_005 3039 3UTR 100% 13.200 9.240 N COL9A1 n/a
6 TRCN0000083367 TCCCTGTCAATTCCAATTCTA pLKO.1 252 CDS 100% 5.625 3.938 N COL9A1 n/a
7 TRCN0000083363 GCTATTCAGTAAGTTCTCTTT pLKO.1 3098 3UTR 100% 4.950 3.465 N COL9A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001851.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10742 pDONR223 100% 35.5% 35.5% None (many diffs) n/a
2 ccsbBroad304_10742 pLX_304 0% 35.5% 35.5% V5 (many diffs) n/a
3 TRCN0000472644 AAATACACGTGAACGCGAAATTCG pLX_317 43.8% 35.5% 35.5% V5 (many diffs) n/a
Download CSV