Transcript: Mouse NM_007740.3

Mus musculus collagen, type IX, alpha 1 (Col9a1), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-14
Taxon:
Mus musculus (mouse)
Gene:
Col9a1 (12839)
Length:
3888
CDS:
246..3011

Additional Resources:

NCBI RefSeq record:
NM_007740.3
NBCI Gene record:
Col9a1 (12839)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_007740.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000090034 CCAAACAAAGTCTGTCGCATT pLKO.1 689 CDS 100% 4.050 5.670 N Col9a1 n/a
2 TRCN0000090036 GCCAAACAAAGTCTGTCGCAT pLKO.1 688 CDS 100% 2.640 3.696 N Col9a1 n/a
3 TRCN0000090033 GCTACTTGACAATCAGATTTA pLKO.1 3133 3UTR 100% 13.200 9.240 N Col9a1 n/a
4 TRCN0000090035 GCTGGGAAGTAATGTAGACTT pLKO.1 509 CDS 100% 4.950 3.465 N Col9a1 n/a
5 TRCN0000090037 CGTGCAAGATTTCCTGCCAAT pLKO.1 327 CDS 100% 4.050 2.835 N Col9a1 n/a
6 TRCN0000083365 GCAGGTTTGCATGAGAGTCAT pLKO.1 2534 CDS 100% 4.950 3.465 N COL9A1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_007740.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_10742 pDONR223 100% 30.4% 31% None (many diffs) n/a
2 ccsbBroad304_10742 pLX_304 0% 30.4% 31% V5 (many diffs) n/a
3 TRCN0000472644 AAATACACGTGAACGCGAAATTCG pLX_317 43.8% 30.4% 31% V5 (many diffs) n/a
Download CSV