Construct: ORF TRCN0000472701
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003526.1_s317c1
- Derived from:
- ccsbBroadEn_01659
- DNA Barcode:
- ATTCAAGTCTCCCTCTATAAATAT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- TERF1 (7013)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472701
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 7013 | TERF1 | telomeric repeat binding fa... | NM_003218.4 | 100% | 100% | |
2 | human | 7013 | TERF1 | telomeric repeat binding fa... | NM_017489.3 | 95.4% | 95.4% | 886_945del |
3 | human | 7013 | TERF1 | telomeric repeat binding fa... | XM_005251292.3 | 93.3% | 93% | 980_1069del |
4 | human | 7013 | TERF1 | telomeric repeat binding fa... | XM_005251291.3 | 89.3% | 89.1% | 886_945del;1040_1129del |
5 | human | 7013 | TERF1 | telomeric repeat binding fa... | XM_017013792.1 | 74.5% | 74.4% | 0_1ins316;2T>G;4_7delTTCA |
6 | human | 7013 | TERF1 | telomeric repeat binding fa... | XM_024447246.1 | 71.1% | 71% | (many diffs) |
7 | human | 7013 | TERF1 | telomeric repeat binding fa... | XM_011517582.3 | 66.6% | 66.3% | (many diffs) |
8 | human | 7013 | TERF1 | telomeric repeat binding fa... | XM_024447247.1 | 58.7% | 58.5% | 0_1ins465;515_604del |
9 | human | 646127 | LOC646127 | telomeric repeat-binding fa... | XR_002958817.1 | 41.1% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1323
- ORF length:
- 1257
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc ggaggatgtt tcctcagcgg ccccgagccc gcggggctgt gcggatggta 121 gggatgccga ccctactgag gagcagatgg cagaaacaga gagaaacgac gaggagcagt 181 tcgaatgcca ggaactgctc gagtgccagg tgcaggtggg ggcccccgag gaggaggagg 241 aggaggagga ggacgcgggc ctggtggccg aggccgaggc cgtggctgcc ggctggatgc 301 tcgatttcct ctgcctctct ctttgccgag ctttccgcga cggccgctcc gaggacttcc 361 gcaggacccg caacagcgca gaggctatta ttcatggact atccagtcta acagcttgcc 421 agttgagaac gatatacata tgtcagtttt tgacaagaat tgcagcagga aaaacccttg 481 atgcacagtt tgaaaatgat gaacgaatta cacccttgga atcagccctg atgatttggg 541 gttcaattga aaaggaacat gacaaacttc atgaagaaat acagaattta attaaaattc 601 aggctatagc tgtttgtatg gaaaatggca actttaaaga agcagaagaa gtctttgaaa 661 gaatatttgg tgatccaaat tctcatatgc ctttcaaaag caaattgctt atgataatct 721 ctcagaaaga tacatttcat tccttttttc aacacttcag ctacaaccac atgatggaga 781 aaattaagag ttatgtgaat tatgtgctaa gtgaaaaatc atcaaCCTTT CTAATGAAGG 841 CAGCGGCAAA AGTAGTAGAA AGCAAAAGGA CAAGAACAAT AACTTCTCAA GATAAACCTA 901 GTGGTAATGA TGTTGAAATG GAAACTGAAG CTAATTTGGA TACAAGAAAA AGGTCTCACA 961 AGAATCTTTT CTTATCTAAG TTGCAACATG GAACCCAGCA ACAAGACCTT AATAAGAAAG 1021 AAAGAAGAGT AGGAACTCCT CAAAGTACAA AAAAGAAAAA AGAAAGCAGA AGAGCCACTG 1081 AAAGCAGAAT ACCTGTTTCA AAGAGTCAGC CGGTAACTCC TGAAAAACAT CGAGCTAGAA 1141 AAAGACAGGC ATGGCTTTGG GAAGAAGACA AGAATTTGAG ATCTGGCGTG AGGAAATATG 1201 GAGAGGGAAA CTGGTCTAAA ATACTGTTGC ATTATAAATT CAACAACCGG ACAAGTGTCA 1261 TGTTAAAAGA CAGATGGAGG ACCATGAAGA AACTAAAACT GATTTCCTCA GACAGCGAAG 1321 ACTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1381 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1441 GGCTTTATAT ATCTTGTGGA AAGGACGAAT TCAAGTCTCC CTCTATAAAT ATACGCGTTA 1501 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt