Transcript: Human XM_005251291.3

PREDICTED: Homo sapiens telomeric repeat binding factor 1 (TERF1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TERF1 (7013)
Length:
3047
CDS:
24..1433

Additional Resources:

NCBI RefSeq record:
XM_005251291.3
NBCI Gene record:
TERF1 (7013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005251291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000040160 CAGAGGGTACAGTATCCTTAT pLKO.1 946 CDS 100% 10.800 15.120 N TERF1 n/a
2 TRCN0000434725 GTTTGTGCTACCAGAGTTAAA pLKO_005 1573 3UTR 100% 13.200 9.240 N TERF1 n/a
3 TRCN0000426735 ACAGTCTGCGGTAACTGAATC pLKO_005 923 CDS 100% 10.800 7.560 N TERF1 n/a
4 TRCN0000418394 AGATCTGGCGTGAGGAAATAT pLKO_005 1287 CDS 100% 15.000 9.000 N TERF1 n/a
5 TRCN0000419670 CCTGTAACGTAACCCATTAAA pLKO_005 1771 3UTR 100% 15.000 9.000 N TERF1 n/a
6 TRCN0000236664 CCGGACAAGTGTCATGTTAAA pLKO_005 1355 CDS 100% 13.200 7.920 N TERF1P5 n/a
7 TRCN0000425245 AGCGAAGACTGATTGTGTTTG pLKO_005 1422 CDS 100% 10.800 6.480 N TERF1 n/a
8 TRCN0000416348 CAAGATAAACCTAGTGGTAAT pLKO_005 846 CDS 100% 10.800 6.480 N TERF1 n/a
9 TRCN0000427961 TGAAAGCAGAATACCTGTTTC pLKO_005 1187 CDS 100% 10.800 6.480 N TERF1 n/a
10 TRCN0000040162 CCCTTGATGCACAGTTTGAAA pLKO.1 433 CDS 100% 5.625 3.375 N TERF1 n/a
11 TRCN0000246128 CAACAGCGCAGAGGCTATTAT pLKO_005 329 CDS 100% 15.000 7.500 Y TERF1P2 n/a
12 TRCN0000246130 CCAGCAACAAGACCTTAATAA pLKO_005 1013 CDS 100% 15.000 7.500 Y TERF1P2 n/a
13 TRCN0000040161 CCCAGCAACAAGACCTTAATA pLKO.1 1012 CDS 100% 15.000 7.500 Y TERF1 n/a
14 TRCN0000418049 ACAGCGCAGAGGCTATTATTC pLKO_005 331 CDS 100% 13.200 6.600 Y TERF1 n/a
15 TRCN0000236661 ACCCAGCAACAAGACCTTAAT pLKO_005 1011 CDS 100% 13.200 6.600 Y TERF1P5 n/a
16 TRCN0000422233 AGCAAATTGCTTATGATAATC pLKO_005 657 CDS 100% 13.200 6.600 Y TERF1 n/a
17 TRCN0000425628 ATGGAAACTGAAGCTAATTTG pLKO_005 876 CDS 100% 13.200 6.600 Y TERF1 n/a
18 TRCN0000040159 GATGGCAGAAACAGAGAGAAA pLKO.1 104 CDS 100% 4.950 2.475 Y TERF1 n/a
19 TRCN0000071301 GAGGCTATTATTCATGGACTA pLKO.1 339 CDS 100% 4.050 2.025 Y Terf1 n/a
20 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 1884 3UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
21 TRCN0000040158 GCGCAATTTCAGCTCACTGAA pLKO.1 1851 3UTR 100% 0.495 0.248 Y TERF1 n/a
22 TRCN0000246131 TCTGTGACCATCAATTAATAT pLKO_005 1550 3UTR 100% 15.000 7.500 Y TERF1P2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005251291.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01659 pDONR223 100% 89.3% 89.1% None 886_945del;1040_1129del n/a
2 ccsbBroad304_01659 pLX_304 0% 89.3% 89.1% V5 886_945del;1040_1129del n/a
3 TRCN0000472701 ATTCAAGTCTCCCTCTATAAATAT pLX_317 39.7% 89.3% 89.1% V5 886_945del;1040_1129del n/a
Download CSV