Construct: ORF TRCN0000472749
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009409.1_s317c1
- Derived from:
- ccsbBroadEn_11038
- DNA Barcode:
- GCAATCTGCAAGGGATGTCTCCCG
- Epitope Tag:
- V5 (not translated due to frame shift)
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PMS1 (5378)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472749
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | NM_001321049.2 | 91.5% | 91.7% | 498_543del |
| 2 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | NM_001321051.1 | 87.5% | 81.2% | (many diffs) |
| 3 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | NM_001321044.2 | 21.7% | 20.1% | (many diffs) |
| 4 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | NM_001128144.2 | 20.6% | 19% | (many diffs) |
| 5 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | XM_017004348.1 | 20.6% | 19% | (many diffs) |
| 6 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | NM_001128143.2 | 17.8% | 16.4% | (many diffs) |
| 7 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | XM_017004344.1 | 17.8% | 16.4% | (many diffs) |
| 8 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | XM_024452966.1 | 17.8% | 16.4% | (many diffs) |
| 9 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | XM_024452967.1 | 17.8% | 16.4% | (many diffs) |
| 10 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | NM_000534.4 | 17% | 15.7% | (many diffs) |
| 11 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | NM_001321045.2 | 17% | 15.7% | (many diffs) |
| 12 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | NM_001321047.2 | 17% | 15.7% | (many diffs) |
| 13 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | NM_001321048.2 | 17% | 15.7% | (many diffs) |
| 14 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | XM_024452964.1 | 17% | 15.7% | (many diffs) |
| 15 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | XM_024452965.1 | 17% | 15.7% | (many diffs) |
| 16 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | NR_110332.2 | 16.5% | (many diffs) | |
| 17 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | XR_922951.2 | 15.2% | (many diffs) | |
| 18 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | XR_001738779.1 | 14.8% | (many diffs) | |
| 19 | human | 5378 | PMS1 | PMS1 homolog 1, mismatch re... | XR_002959307.1 | 14.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 564
- ORF length:
- 498
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa acaattgcct gcggcaacag ttcgactcct ttcaagttct cagatcatca 121 cttcggtggt cagtgttgta aaagagctta ttgaaaactc cttggatgct ggtgccacaa 181 gcgtagatgt taaactggag aactatggat ttgataaaat tgaggtgcga gataacgggg 241 agggtatcaa ggctgttgat gcacctgtaa tggcaatgaa gtactacacc tcaaaaataa 301 atagtcatga agatcttgaa aatttgacaa cttacggttt tcgtggagaa gccTTGGGGT 361 CAATTTGTTG TATAGCTGAG GTTTTAATTA CAACAAGAAC GGCTGCTGAT AATTTTAGCA 421 CCCAGTATGT TTTAGATGGC AGTGGCCACA TACTTTCTCA GAAACCTTCA CATCTTGGTC 481 AAGGTAAGAA AGTAGCTTTG TATACAAACA TTCTTTACCT TTTCTGTCTT AATTGTTGGT 541 TTAAAAAAAA AAAGTTACTC GGTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA 601 GCCTATCCCT AACCCTCTCC TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT 661 TGAAAGTATT TCGATTTCTT GGCTTTATAT ATCTTGTGGA AAGGACGAGC AATCTGCAAG 721 GGATGTCTCC CGACGCGTTA AGTCgacaat caacctctgg attacaaaat ttgtgaaaga 781 tt