Transcript: Human NM_000534.4

Homo sapiens PMS1 homolog 1, mismatch repair system component (PMS1), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PMS1 (5378)
Length:
3538
CDS:
530..3328

Additional Resources:

NCBI RefSeq record:
NM_000534.4
NBCI Gene record:
PMS1 (5378)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_000534.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235495 ATGGCAATAAAGACCATATAG pLKO_005 1935 CDS 100% 13.200 18.480 N PMS1 n/a
2 TRCN0000235494 GGACCATTACCTAGTACAAAT pLKO_005 1541 CDS 100% 13.200 18.480 N PMS1 n/a
3 TRCN0000010072 CTTCGGTGGTCAGTGTTGTAA pLKO.1 585 CDS 100% 5.625 7.875 N PMS1 n/a
4 TRCN0000010066 CAAGCGTAGATGTTAAACTGG pLKO.1 642 CDS 100% 2.640 3.696 N PMS1 n/a
5 TRCN0000235493 CCTCGCAAAGTGATAAGTTAT pLKO_005 3137 CDS 100% 13.200 9.240 N PMS1 n/a
6 TRCN0000235496 GGAACGATACAATAGTCAAAT pLKO_005 2413 CDS 100% 13.200 9.240 N PMS1 n/a
7 TRCN0000235492 TGAAATTGGTTCTGTCATAAA pLKO_005 3359 3UTR 100% 13.200 9.240 N PMS1 n/a
8 TRCN0000010067 GCACCTGTAATGGCAATGAAG pLKO.1 725 CDS 100% 4.950 3.465 N PMS1 n/a
9 TRCN0000010073 ATTACAACAAGAACGGCTGCT pLKO.1 851 CDS 100% 2.160 1.512 N PMS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_000534.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11039 pDONR223 100% 71.7% 71.6% None 1857_2342del;2494_2796del n/a
2 ccsbBroad304_11039 pLX_304 0% 71.7% 71.6% V5 1857_2342del;2494_2796del n/a
3 TRCN0000474660 ATTCTACCGCGGCGAATGCGGTCG pLX_317 27.4% 71.7% 71.6% V5 1857_2342del;2494_2796del n/a
4 ccsbBroadEn_11038 pDONR223 100% 17% 15.7% None (many diffs) n/a
5 ccsbBroad304_11038 pLX_304 0% 17% 15.7% V5 (many diffs) n/a
6 TRCN0000472749 GCAATCTGCAAGGGATGTCTCCCG pLX_317 42.5% 17% 15.7% V5 (not translated due to frame shift) (many diffs) n/a
7 TRCN0000489952 CTTCACAGTAGCCTGCTCCATTTT pLX_317 80.6% 17% 15.7% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV