Transcript: Human NM_001286794.1

Homo sapiens spermatogenesis associated 13 (SPATA13), transcript variant 5, mRNA.

Source:
NCBI, updated 2018-06-30
Taxon:
Homo sapiens (human)
Gene:
SPATA13 (221178)
Length:
6405
CDS:
314..2104

Additional Resources:

NCBI RefSeq record:
NM_001286794.1
NBCI Gene record:
SPATA13 (221178)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001286794.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000186369 CGGTGATTACAGCAACATAAA pLKO.1 1348 CDS 100% 13.200 18.480 N SPATA13 n/a
2 TRCN0000363971 TTGCGCAGCTAGCCACTATTT pLKO_005 981 CDS 100% 13.200 18.480 N Spata13 n/a
3 TRCN0000187684 CACGGTGATTACAGCAACATA pLKO.1 1346 CDS 100% 5.625 3.938 N SPATA13 n/a
4 TRCN0000188181 CCACAGACACTGTGAGAACAA pLKO.1 835 CDS 100% 4.950 3.465 N SPATA13 n/a
5 TRCN0000186516 GCTCTTACTCTCTTCTGTAAT pLKO.1 2589 3UTR 100% 13.200 7.920 N SPATA13 n/a
6 TRCN0000078113 GCCTGTAATCCCAGCACTTTA pLKO.1 2975 3UTR 100% 13.200 6.600 Y LIAS n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001286794.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09869 pDONR223 100% 87.1% 83% None (many diffs) n/a
2 ccsbBroad304_09869 pLX_304 0% 87.1% 83% V5 (many diffs) n/a
3 TRCN0000472801 GTTAGCTATAAGACTTGCTAATTA pLX_317 19.5% 87.1% 83% V5 (many diffs) n/a
Download CSV