Construct: ORF TRCN0000472860
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007742.1_s317c1
- Derived from:
- ccsbBroadEn_07251
- DNA Barcode:
- ATCACAACTATCGTTATTTACCGC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- KCNAB2 (8514)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472860
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8514 | KCNAB2 | potassium voltage-gated cha... | NM_001199860.2 | 99.9% | 100% | 1032A>G |
| 2 | human | 8514 | KCNAB2 | potassium voltage-gated cha... | NM_001199861.2 | 99.9% | 100% | 1032A>G |
| 3 | human | 8514 | KCNAB2 | potassium voltage-gated cha... | NM_003636.4 | 99.9% | 100% | 1032A>G |
| 4 | human | 8514 | KCNAB2 | potassium voltage-gated cha... | NM_172130.3 | 96% | 96.1% | 72_73ins42;990A>G |
| 5 | human | 8514 | KCNAB2 | potassium voltage-gated cha... | XM_005263514.3 | 96% | 96.1% | 72_73ins42;990A>G |
| 6 | human | 8514 | KCNAB2 | potassium voltage-gated cha... | XM_011542321.3 | 89.8% | 86.7% | (many diffs) |
| 7 | human | 8514 | KCNAB2 | potassium voltage-gated cha... | XM_011542322.2 | 89.8% | 86.7% | (many diffs) |
| 8 | human | 8514 | KCNAB2 | potassium voltage-gated cha... | XM_017002620.1 | 88% | 79.5% | (many diffs) |
| 9 | human | 8514 | KCNAB2 | potassium voltage-gated cha... | NM_001199862.2 | 84.8% | 76.8% | (many diffs) |
| 10 | human | 8514 | KCNAB2 | potassium voltage-gated cha... | XM_017002618.2 | 83.8% | 75.9% | (many diffs) |
| 11 | human | 8514 | KCNAB2 | potassium voltage-gated cha... | XM_017002619.1 | 83.8% | 75.9% | (many diffs) |
| 12 | human | 8514 | KCNAB2 | potassium voltage-gated cha... | NM_001199863.2 | 81.6% | 81.7% | 0_1ins201;831A>G |
| 13 | human | 8514 | KCNAB2 | potassium voltage-gated cha... | XM_017002621.2 | 80.9% | 73.4% | (many diffs) |
| 14 | mouse | 16498 | Kcnab2 | potassium voltage-gated cha... | NM_001252656.1 | 90.8% | 98.9% | (many diffs) |
| 15 | mouse | 16498 | Kcnab2 | potassium voltage-gated cha... | NM_010598.3 | 90.8% | 98.9% | (many diffs) |
| 16 | mouse | 16498 | Kcnab2 | potassium voltage-gated cha... | XM_017319996.1 | 90.8% | 98.9% | (many diffs) |
| 17 | mouse | 16498 | Kcnab2 | potassium voltage-gated cha... | NM_001252654.1 | 87.1% | 95% | (many diffs) |
| 18 | mouse | 16498 | Kcnab2 | potassium voltage-gated cha... | NM_001252655.1 | 87.1% | 95% | (many diffs) |
| 19 | mouse | 16498 | Kcnab2 | potassium voltage-gated cha... | XM_006538583.3 | 87% | 94.7% | (many diffs) |
| 20 | mouse | 16498 | Kcnab2 | potassium voltage-gated cha... | XM_006538584.3 | 87% | 94.7% | (many diffs) |
| 21 | mouse | 16498 | Kcnab2 | potassium voltage-gated cha... | XM_006538585.3 | 87% | 94.7% | (many diffs) |
| 22 | mouse | 16498 | Kcnab2 | potassium voltage-gated cha... | XM_011250199.2 | 87% | 94.7% | (many diffs) |
| 23 | mouse | 16498 | Kcnab2 | potassium voltage-gated cha... | XM_006538586.3 | 83.4% | 91.1% | (many diffs) |
| 24 | mouse | 16498 | Kcnab2 | potassium voltage-gated cha... | XM_006538587.3 | 83.4% | 91.1% | (many diffs) |
| 25 | mouse | 16498 | Kcnab2 | potassium voltage-gated cha... | XM_011250198.2 | 81.5% | 79.2% | (many diffs) |
| 26 | mouse | 16498 | Kcnab2 | potassium voltage-gated cha... | XM_011250197.2 | 78.4% | 76.3% | (many diffs) |
| 27 | mouse | 16498 | Kcnab2 | potassium voltage-gated cha... | XM_017319997.1 | 70.7% | 77.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1170
- ORF length:
- 1101
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat gtatccagaa tcaacgacgg gctccccggc tcggctctcg ctgcggcaga 121 cgggctcccc cgggatgatc tacagtactc ggtatgggag tcccaaaaga cagctccagt 181 tttacaggaa cctgggcaag tctggcctgc gggtctcctg cctgggactt ggaacatggg 241 tgaccttcgg aggccagatc accgatgaga tggcagagca gctcatgacc ttggcctatg 301 ataatggcat caacctcttc gatacagcag aagtctacgc agccggcaag gctgaagtgg 361 tactgggaaa catcattaag aagaaaggat ggaggcggtc cagcctcgtc atcaccacca 421 agatcttctg gggcggaaag gcggagacgg agcggggcct gtccaggaag cacataatcg 481 aaggtctgaa agcttccctg gagcgactgc agctggagta cgtggatgtg gtgtttgcca 541 accgcccgga ccccaacacc ccgatggaag agaccgtccg cgccatgacc cacgtcatca 601 accaggggat ggccatgtac tggggcacgt cacgctggag ctccatggag atcatggagg 661 cctactccgt ggcccggcag ttcaacctga ccccgcccat ctgcgagcag gctgagtacc 721 acatgttcca gcgtgagaaa gtggaggtgc agctgccgga gctgttccac aagataggag 781 tgggcgccat gacctggtcc cctctggcct gtggcattgt ttctggcaag tacgacagtg 841 gcatcccacc ctactcaaga gcctccttga agggctacca gtggctgaag gacaagatcc 901 tcagtgagga gggccggcgc cagcaagcca agctgaagga gctgcaggcc atcgccgagc 961 gcctgggctg caccctgccc cagctggcca tagccTGGTG CCTGAGGAAT GAGGGAGTCA 1021 GCTCCGTGCT CCTGGGGGCC TCCAATGCGG ACCAGCTCAT GGAGAACATT GGGGCAATAC 1081 AGGTCCTTCC GAAACTGTCG TCTTCCATTA TCCACGAGAT TGATAGTATT TTGGGCAATA 1141 AACCCTACAG CAAAAAGGAC TACAGATCCT TGCCAACTTT CTTGTACAAA GTGGTTGATA 1201 TCGGTAAGCC TATCCCTAAC CCTCTCCTCG GTCTCGATTC TACGTAGTAA TGAACTAGTC 1261 CGTAACTTGA AAGTATTTCG ATTTCTTGGC TTTATATATC TTGTGGAAAG GACGAATCAC 1321 AACTATCGTT ATTTACCGCA CGCGTTAAGT Cgacaatcaa cctctggatt acaaaatttg 1381 tgaaagatt