Transcript: Human XM_011542321.3

PREDICTED: Homo sapiens potassium voltage-gated channel subfamily A regulatory beta subunit 2 (KCNAB2), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KCNAB2 (8514)
Length:
1455
CDS:
170..1357

Additional Resources:

NCBI RefSeq record:
XM_011542321.3
NBCI Gene record:
KCNAB2 (8514)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011542321.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000044862 TCCACGAGATTGATAGTATTT pLKO.1 1410 3UTR 100% 13.200 18.480 N KCNAB2 n/a
2 TRCN0000044861 CCTCGTCATCACCACCAAGAT pLKO.1 505 CDS 100% 4.950 3.465 N KCNAB2 n/a
3 TRCN0000044859 CCTGTCCAGGAAGCACATAAT pLKO.1 559 CDS 100% 13.200 7.920 N KCNAB2 n/a
4 TRCN0000044858 CGAAACTGTCATCTTCCATTA pLKO.1 1389 3UTR 100% 10.800 6.480 N KCNAB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011542321.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11276 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_11276 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000475529 TAGCAGGGTTTTGGCGTATTCCCC pLX_317 9.9% 100% 100% V5 n/a
4 ccsbBroadEn_07251 pDONR223 100% 89.8% 86.7% None (many diffs) n/a
5 ccsbBroad304_07251 pLX_304 0% 89.8% 86.7% V5 (many diffs) n/a
6 TRCN0000472860 ATCACAACTATCGTTATTTACCGC pLX_317 16.4% 89.8% 86.7% V5 (many diffs) n/a
Download CSV