Construct: ORF TRCN0000472903
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF014623.1_s317c1
- Derived from:
- ccsbBroadEn_02483
- DNA Barcode:
- ACGGAGAACTCGCACTCCCTGGTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PAIP1 (10605)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472903
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 10605 | PAIP1 | poly(A) binding protein int... | NM_182789.3 | 100% | 100% | |
| 2 | human | 10605 | PAIP1 | poly(A) binding protein int... | NM_183323.2 | 91.7% | 91.7% | 0_1ins99 |
| 3 | human | 10605 | PAIP1 | poly(A) binding protein int... | XM_005248230.4 | 91.7% | 91.7% | 0_1ins99 |
| 4 | human | 10605 | PAIP1 | poly(A) binding protein int... | XM_017008956.2 | 91.7% | 91.7% | 0_1ins99 |
| 5 | human | 10605 | PAIP1 | poly(A) binding protein int... | NM_006451.5 | 82.1% | 83.5% | (many diffs) |
| 6 | mouse | 218693 | Paip1 | polyadenylate binding prote... | NM_145457.4 | 92.8% | 97.7% | (many diffs) |
| 7 | mouse | 218693 | Paip1 | polyadenylate binding prote... | NM_001079849.2 | 85% | 90.2% | (many diffs) |
| 8 | mouse | 218693 | Paip1 | polyadenylate binding prote... | XM_006517634.3 | 85% | 90.2% | (many diffs) |
| 9 | mouse | 218693 | Paip1 | polyadenylate binding prote... | XM_006517631.3 | 76.2% | 79.2% | (many diffs) |
| 10 | mouse | 218693 | Paip1 | polyadenylate binding prote... | XM_006517632.3 | 71% | 73.6% | (many diffs) |
| 11 | mouse | 218693 | Paip1 | polyadenylate binding prote... | XM_006517633.3 | 61.1% | 65% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1266
- ORF length:
- 1200
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc ggacggtttc gatcgggccc cagagcaaac gaggcccctg agagctccac 121 ctagttcaca ggataaaatc ccacagcaga actcggagtc agcaatggct aagccccagg 181 tggttgtagc tcctgtatta atgtctaagc tgtctgtgaa tgcccctgaa ttttaccctt 241 caggttattc ttccagttac acagaatcct atgaggatgg ttgtgaggat tatcctactc 301 tatcagaata tgttcaggat tttttgaatc atcttacaga gcagcctggc agttttgaaa 361 ctgaaattga acagtttgca gagaccctga atggttgtgt tacaacagat gatgctttgc 421 aagaacttgt ggaactcatc tatcaacagg ccacatctat cccaaatttc tcttatatgg 481 gagctcgcct gtgtaattac ctgtcccatc atctgacaat tagcccacag agtggcaact 541 tccgccaatt gctacttcaa agatgtcgga ctgaatatga agttaaagat caagctgcaa 601 aaggggatga agttactcga aaacgatttc atgcatttgt actctttctg ggagaacttt 661 atcttaacct ggagatcaag ggaacaaatg gacaggttac aagagcagat attcttcagg 721 ttggtcttcg agaattgctg aatgccctgt tttctaatcc tatgGATGAC AATTTAATTT 781 GTGCAGTAAA ATTGTTAAAG TTGACAGGAT CAGTTTTGGA AGATGCTTGG AAGGAAAAAG 841 GAAAGATGGA TATGGAAGAA ATTATTCAGA GAATTGAAAA CGTTGTCCTA GATGCAAACT 901 GCAGTAGAGA TGTAAAACAG ATGCTCTTGA AGCTTGTAGA ACTCCGGTCA AGTAACTGGG 961 GCAGAGTCCA TGCAACTTCA ACATATAGAG AAGCAACACC AGAAAATGAT CCTAACTACT 1021 TTATGAATGA ACCAACATTT TATACATCTG ATGGTGTTCC TTTCACTGCA GCTGATCCAG 1081 ATTACCAAGA GAAATACCAA GAATTACTTG AAAGAGAGGA CTTTTTTCCA GATTATGAAG 1141 AAAATGGAAC AGATTTATCC GGGGCTGGTG ATCCATACTT GGATGATATT GATGATGAGA 1201 TGGACCCAGA GATAGAAGAA GCTTATGAAA AGTTTTGTTT GGAATCAGAG CGTAAGCGAA 1261 AACAGTACCC AACTTTCTTG TACAAAGTGG TTGATATCGG TAAGCCTATC CCTAACCCTC 1321 TCCTCGGTCT CGATTCTACG TAGTAATGAA CTAGTCCGTA ACTTGAAAGT ATTTCGATTT 1381 CTTGGCTTTA TATATCTTGT GGAAAGGACG AACGGAGAAC TCGCACTCCC TGGTCACGCG 1441 TTAAGTCgac aatcaacctc tggattacaa aatttgtgaa agatt