Transcript: Human XM_017008956.2

PREDICTED: Homo sapiens poly(A) binding protein interacting protein 1 (PAIP1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PAIP1 (10605)
Length:
2675
CDS:
487..1590

Additional Resources:

NCBI RefSeq record:
XM_017008956.2
NBCI Gene record:
PAIP1 (10605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017008956.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000201571 CCACCTAGTTCACAGGATAAA pLKO.1 439 5UTR 100% 13.200 18.480 N Paip1 n/a
2 TRCN0000278635 CCACCTAGTTCACAGGATAAA pLKO_005 439 5UTR 100% 13.200 18.480 N Paip1 n/a
3 TRCN0000240133 GCAGTTTAGGTATGGTGATTT pLKO_005 1621 3UTR 100% 13.200 18.480 N LOC645139 n/a
4 TRCN0000240130 TCGGACTGAATATGAAGTTAA pLKO_005 888 CDS 100% 13.200 18.480 N LOC645139 n/a
5 TRCN0000243815 AGTGGCAACTTCCGCCAATTG pLKO_005 853 CDS 100% 10.800 15.120 N LOC651789 n/a
6 TRCN0000240129 GAGTGGCAACTTCCGCCAATT pLKO_005 852 CDS 100% 10.800 15.120 N LOC645139 n/a
7 TRCN0000129865 GCTAGTTGGTTAGATGCTTAT pLKO.1 1874 3UTR 100% 10.800 15.120 N PAIP1 n/a
8 TRCN0000243812 GTAGAACTCCGGTCAAGTAAC pLKO_005 1258 CDS 100% 10.800 8.640 N LOC651789 n/a
9 TRCN0000127832 GCTATTTGATACCAAGGGCTT pLKO.1 2115 3UTR 100% 2.160 1.728 N PAIP1 n/a
10 TRCN0000243813 CAGTTTAGGTATGGTGATTTA pLKO_005 1622 3UTR 100% 13.200 9.240 N LOC651789 n/a
11 TRCN0000129781 CCAAGACTTCACTGAAGATTT pLKO.1 2189 3UTR 100% 13.200 9.240 N PAIP1 n/a
12 TRCN0000243814 CTAATCCTATGGATGACAATT pLKO_005 1076 CDS 100% 13.200 9.240 N LOC651789 n/a
13 TRCN0000343024 GGTTAGATGCTTATCCTTTAA pLKO_005 1881 3UTR 100% 13.200 9.240 N PAIP1 n/a
14 TRCN0000130953 CCTGTCCCATCATCTGACAAT pLKO.1 822 CDS 100% 4.950 3.465 N PAIP1 n/a
15 TRCN0000127843 GAATTGCTGAATGCCCTGTTT pLKO.1 1054 CDS 100% 4.950 3.465 N PAIP1 n/a
16 TRCN0000342959 GAATTGCTGAATGCCCTGTTT pLKO_005 1054 CDS 100% 4.950 3.465 N PAIP1 n/a
17 TRCN0000130823 GAGTCCATGCAACTTCAACAT pLKO.1 1286 CDS 100% 4.950 3.465 N PAIP1 n/a
18 TRCN0000129266 CTTCAGGTTGGTCTTCGAGAA pLKO.1 1036 CDS 100% 4.050 2.835 N PAIP1 n/a
19 TRCN0000342958 CTTCAGGTTGGTCTTCGAGAA pLKO_005 1036 CDS 100% 4.050 2.835 N PAIP1 n/a
20 TRCN0000342960 AGGATGGTTGTGAGGATTATC pLKO_005 596 CDS 100% 13.200 7.920 N PAIP1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017008956.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02483 pDONR223 100% 91.7% 91.7% None 0_1ins99 n/a
2 ccsbBroad304_02483 pLX_304 0% 91.7% 91.7% V5 0_1ins99 n/a
3 TRCN0000472903 ACGGAGAACTCGCACTCCCTGGTC pLX_317 41.9% 91.7% 91.7% V5 0_1ins99 n/a
Download CSV