Construct: ORF TRCN0000472979
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009015.1_s317c1
- Derived from:
- ccsbBroadEn_11417
- DNA Barcode:
- CCGGTCCTGCGAGCCAACCTATTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- IST1 (9798)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472979
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 9798 | IST1 | IST1 factor associated with... | NM_001270977.2 | 100% | 100% | |
| 2 | human | 9798 | IST1 | IST1 factor associated with... | NM_001270975.2 | 91.5% | 91.5% | 760_852del |
| 3 | human | 9798 | IST1 | IST1 factor associated with... | NM_014761.4 | 90.4% | 74.3% | 760_761delTCinsGT;764_852del;1080_1081insTGAAAAAGAAAACA |
| 4 | human | 9798 | IST1 | IST1 factor associated with... | NM_001270976.1 | 88.3% | 88.3% | 1_39del;799_891del |
| 5 | human | 9798 | IST1 | IST1 factor associated with... | NM_001270978.2 | 51% | 51% | 0_1ins444;316_408del |
| 6 | human | 9798 | IST1 | IST1 factor associated with... | NM_001270979.1 | 51% | 51% | 0_1ins444;316_408del |
| 7 | mouse | 71955 | Ist1 | increased sodium tolerance ... | XM_017312970.1 | 83.7% | 88.5% | (many diffs) |
| 8 | mouse | 71955 | Ist1 | increased sodium tolerance ... | NM_028018.2 | 81.3% | 86.6% | (many diffs) |
| 9 | mouse | 71955 | Ist1 | increased sodium tolerance ... | XM_017312971.1 | 64.6% | 68% | (many diffs) |
| 10 | mouse | 71955 | Ist1 | increased sodium tolerance ... | XR_001778470.1 | 36.1% | (many diffs) | |
| 11 | mouse | 71955 | Ist1 | increased sodium tolerance ... | XR_001778469.1 | 35.5% | (many diffs) | |
| 12 | mouse | 71955 | Ist1 | increased sodium tolerance ... | XR_001778468.1 | 32.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1071
- ORF length:
- 1005
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgct gggctctgga tttaaagctg agcgcttaag agtgaatttg agattagtca 121 taaatcgcct taaactattg gagaaaaaga aaacggaact ggcccagaaa gcaaggaagg 181 agattgctga ctatctggct gctgggaaag atgaacgagc tcggatccgt gtggagcaca 241 ttatccggga agactacctc gtggaggcca tggagatcct ggagctgtac tgtgacctgc 301 tgctggctcg gtttggcctt atccagtcta tgaaggaact agattctggt ctggctgaat 361 ctgtgtctac attgatctgg gctgctcctc gactccagtc agaagtggct gagttgaaaa 421 tagttgctga tcagctctgt gccaagtata gcaaggaata tggcaagcta tgtaggacca 481 accagattgg aactgtgaat gacaggctaa tgcacaagct gagtgtggaa gccccaccca 541 aaatcctggt ggagagatac ctgattgaaa ttgcaaagaa ttacaacgta ccctatgaac 601 ctgactctgt ggtcatggca gaagctcctc ctggggtaga gacagatctt attgatgttg 661 gattcacaga tgatgtgaag aaaggaggcc ctggaagagg agggagtggt ggcttcacag 721 caccagttgg tggacctgat ggaacggtgc CAATGCCCAT GCCCATGCCC ATGCCTATGC 781 CATCTGCAAA TACGCCTTTC TCATATCCAC TGCCAAAGGG ACCAGTAGAT GACATTAATG 841 CTGATAAGAA TATCTCTTCT GCACAGATTG TTGGTCCTGG ACCCAAGCCA GAAGCCTCTG 901 CAAAGCTTCC TTCCAGACCT GCAGATAACT ATGACAACTT TGTCCTACCA GAGTTGCCAT 961 CTGTGCCAGA CACACTACCA ACTGCATCTG CTGGTGCCAG CACCTCAGCA TCTGAAGACA 1021 TTGACTTTGA TGATCTTTCC CGGAGGTTTG AAGAGCTGAA AAAGAAAACA TACCCAACTT 1081 TCTTGTACAA AGTGGTTGAT ATCGGTAAGC CTATCCCTAA CCCTCTCCTC GGTCTCGATT 1141 CTACGTAGTA ATGAACTAGT CCGTAACTTG AAAGTATTTC GATTTCTTGG CTTTATATAT 1201 CTTGTGGAAA GGACGACCGG TCCTGCGAGC CAACCTATTG ACGCGTTAAG TCgacaatca 1261 acctctggat tacaaaattt gtgaaagatt