Transcript: Mouse XR_001778470.1

PREDICTED: Mus musculus increased sodium tolerance 1 homolog (yeast) (Ist1), transcript variant X4, misc_RNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Ist1 (71955)
Length:
2458
CDS:
(non-coding)

Additional Resources:

NCBI RefSeq record:
XR_001778470.1
NBCI Gene record:
Ist1 (71955)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the exonic sequence of this non-coding transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XR_001778470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000266805 TTCCAGACCTGTGGATAATTA pLKO_005 1169 3UTR 100% 15.000 21.000 N Ist1 n/a
2 TRCN0000266804 CATCCGTGTGGAGCACATAAT pLKO_005 283 3UTR 100% 13.200 18.480 N Ist1 n/a
3 TRCN0000216431 GTTTCAACCTTGACTCGTAAA pLKO.1 1701 3UTR 100% 10.800 15.120 N Ist1 n/a
4 TRCN0000266803 TTCAACCTTGACTCGTAAATA pLKO_005 1703 3UTR 100% 15.000 10.500 N Ist1 n/a
5 TRCN0000191849 GAGAGATACCTGATTGAAATT pLKO.1 611 3UTR 100% 13.200 9.240 N Ist1 n/a
6 TRCN0000266802 GGGTGGAGACAGATCTTATTG pLKO_005 693 3UTR 100% 13.200 9.240 N Ist1 n/a
7 TRCN0000200918 CGTCTCAAACTGTTGGAGAAA pLKO.1 185 3UTR 100% 4.950 3.465 N Ist1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XR_001778470.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02245 pDONR223 100% 38.8% None (many diffs) n/a
2 ccsbBroad304_02245 pLX_304 0% 38.8% V5 (many diffs) n/a
3 TRCN0000471238 CTGAAGCGTGGCCCAGTTTTCTCT pLX_317 38.1% 38.8% V5 (many diffs) n/a
4 ccsbBroadEn_11417 pDONR223 100% 36.1% None (many diffs) n/a
5 ccsbBroad304_11417 pLX_304 0% 36.1% V5 (many diffs) n/a
6 TRCN0000472979 CCGGTCCTGCGAGCCAACCTATTG pLX_317 32.2% 36.1% V5 (many diffs) n/a
Download CSV