Construct: ORF TRCN0000472989
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006346.3_s317c1
- Derived from:
- ccsbBroadEn_04543
- DNA Barcode:
- ACACGTCTTGCCCTATAAAGGTTC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ATP23 (91419)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000472989
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 91419 | ATP23 | ATP23 metallopeptidase and ... | NM_033276.4 | 100% | 100% | |
2 | human | 91419 | ATP23 | ATP23 metallopeptidase and ... | NM_001320408.2 | 77% | 72.4% | (many diffs) |
3 | human | 91419 | ATP23 | ATP23 metallopeptidase and ... | XM_011538976.2 | 70.7% | 69.5% | (many diffs) |
4 | human | 91419 | ATP23 | ATP23 metallopeptidase and ... | XM_017020206.1 | 70.7% | 70.7% | 0_1ins216 |
5 | human | 91419 | ATP23 | ATP23 metallopeptidase and ... | NM_001320409.2 | 52% | 52% | 0_1ins354 |
6 | human | 91419 | ATP23 | ATP23 metallopeptidase and ... | NM_001320410.2 | 52% | 52% | 0_1ins354 |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 804
- ORF length:
- 738
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc gggagctccg gacgagcgcc ggcggggccc cgcggcaggg gagcagctgc 121 agcagcaaca cgtctcttgc caggtcttcc ccgagcgtct ggcccagggg aatccccagc 181 aagggttctt ctccagcttc ttcaccagca accagaagtg ccagcttagg ctcctgaaga 241 cgctggagac aaatccatat gtcaaacttc tgcttgatgc tatgaaacac tcaggttgtg 301 ctgttaacaa agatagacac ttttcttgcg aagactgtaa tggaaatgtc agtggaggtt 361 ttgatgcttc aacatctcag atagttttgt gccagaataa tatccataat caggcccata 421 tgaacagagt ggtcacacac gagcttattc atgcatttga tcattgtcgt gcccatgtcg 481 actggttcac caacaTCAGA CATTTGGCGT GCTCAGAGGT TCGAGCTGCT AACCTTAGTG 541 GAGACTGCTC ACTTGTCAAT GAAATATTCA GGTTACATTT TGGATTAAAA CAACACCACC 601 AGACTTGTGT GCGAGACAGA GCCACTCTTT CTATCCTGGC TGTTAGGAAT ATCAGCAAAG 661 AAGTAGCTAA AAAGGCTGTT GATGAAGTTT TTGAATCTTG TTTCAATGAC CATGAACCTT 721 TTGGAAGGAT CCCACATAAC AAGACTTATG CAAGATATGC TCACAGAGAC TTTGAAAACC 781 GTGATCGGTA TTATTCAAAT ATATGCCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 841 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 901 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAA CACGTCTTGC 961 CCTATAAAGG TTCACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1021 att