Transcript: Human XM_011538976.2

PREDICTED: Homo sapiens ATP23 metallopeptidase and ATP synthase assembly factor homolog (ATP23), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATP23 (91419)
Length:
865
CDS:
36..614

Additional Resources:

NCBI RefSeq record:
XM_011538976.2
NBCI Gene record:
ATP23 (91419)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148186 GTTGGTGAACCAGTCGACAT pXPR_003 GGG 250 43% 3 0.953 ATP23 ATP23 77437
2 BRDN0001146795 CAAGTGAGCAGTCTCCACTA pXPR_003 AGG 311 54% 4 0.9416 ATP23 ATP23 77434
3 BRDN0001145935 TCAGGCCCATATGAACAGAG pXPR_003 TGG 199 34% 3 0.7771 ATP23 ATP23 77435
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011538976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358942 TGGTCACACACGAGCTTATTC pLKO_005 238 CDS 100% 13.200 18.480 N ATP23 n/a
2 TRCN0000135049 CCGTGATCGGTATTATTCAAA pLKO.1 587 CDS 100% 5.625 7.875 N ATP23 n/a
3 TRCN0000135720 GACTGCTCACTTGTCAATGAA pLKO.1 351 CDS 100% 5.625 7.875 N ATP23 n/a
4 TRCN0000134682 GTTTCAATGACCATGAACCTT pLKO.1 508 CDS 100% 3.000 4.200 N ATP23 n/a
5 TRCN0000359024 GACTGTGATTCTAGCATATTA pLKO_005 734 3UTR 100% 15.000 10.500 N ATP23 n/a
6 TRCN0000359023 TGCCAGAATAATATCCATAAT pLKO_005 198 CDS 100% 13.200 9.240 N ATP23 n/a
7 TRCN0000358941 ATCAGCAAAGAAGTAGCTAAA pLKO_005 459 CDS 100% 10.800 7.560 N ATP23 n/a
8 TRCN0000134270 GCTTCAACATCTCAGATAGTT pLKO.1 174 CDS 100% 5.625 3.938 N ATP23 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011538976.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04543 pDONR223 100% 70.7% 69.5% None (many diffs) n/a
2 ccsbBroad304_04543 pLX_304 0% 70.7% 69.5% V5 (many diffs) n/a
3 TRCN0000472989 ACACGTCTTGCCCTATAAAGGTTC pLX_317 42% 70.7% 69.5% V5 (many diffs) n/a
4 ccsbBroadEn_15210 pDONR223 0% 70.7% 69.5% None (many diffs) n/a
5 ccsbBroad304_15210 pLX_304 0% 70.7% 69.5% V5 (many diffs) n/a
6 TRCN0000474846 GCATACCGGTTGAGACATCATGGT pLX_317 67% 70.7% 69.5% V5 (many diffs) n/a
Download CSV