Transcript: Human NM_001320408.2

Homo sapiens ATP23 metallopeptidase and ATP synthase assembly factor homolog (ATP23), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ATP23 (91419)
Length:
3174
CDS:
332..916

Additional Resources:

NCBI RefSeq record:
NM_001320408.2
NBCI Gene record:
ATP23 (91419)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148186 GTTGGTGAACCAGTCGACAT pXPR_003 GGG 256 44% 4 0.953 ATP23 ATP23 77437
2 BRDN0001146795 CAAGTGAGCAGTCTCCACTA pXPR_003 AGG 317 54% 5 0.9312 ATP23 ATP23 77434
3 BRDN0001145935 TCAGGCCCATATGAACAGAG pXPR_003 TGG 205 35% 4 0.7619 ATP23 ATP23 77435
4 BRDN0001148272 CTTGATGCTATGAAACACTC pXPR_003 AGG 68 12% 2 0.3098 ATP23 ATP23 77436
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001320408.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358942 TGGTCACACACGAGCTTATTC pLKO_005 540 CDS 100% 13.200 18.480 N ATP23 n/a
2 TRCN0000135049 CCGTGATCGGTATTATTCAAA pLKO.1 889 CDS 100% 5.625 7.875 N ATP23 n/a
3 TRCN0000135720 GACTGCTCACTTGTCAATGAA pLKO.1 653 CDS 100% 5.625 7.875 N ATP23 n/a
4 TRCN0000134682 GTTTCAATGACCATGAACCTT pLKO.1 810 CDS 100% 3.000 4.200 N ATP23 n/a
5 TRCN0000359024 GACTGTGATTCTAGCATATTA pLKO_005 1036 3UTR 100% 15.000 10.500 N ATP23 n/a
6 TRCN0000359023 TGCCAGAATAATATCCATAAT pLKO_005 500 CDS 100% 13.200 9.240 N ATP23 n/a
7 TRCN0000358941 ATCAGCAAAGAAGTAGCTAAA pLKO_005 761 CDS 100% 10.800 7.560 N ATP23 n/a
8 TRCN0000134270 GCTTCAACATCTCAGATAGTT pLKO.1 476 CDS 100% 5.625 3.938 N ATP23 n/a
9 TRCN0000136198 GCTATGAAACACTCAGGTTGT pLKO.1 389 CDS 100% 4.050 2.835 N ATP23 n/a
10 TRCN0000135330 CCAAATGAGAAGGAACCAGAA pLKO.1 2800 3UTR 100% 4.050 2.025 Y SPTLC3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001320408.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04543 pDONR223 100% 77% 72.4% None (many diffs) n/a
2 ccsbBroad304_04543 pLX_304 0% 77% 72.4% V5 (many diffs) n/a
3 TRCN0000472989 ACACGTCTTGCCCTATAAAGGTTC pLX_317 42% 77% 72.4% V5 (many diffs) n/a
4 ccsbBroadEn_15210 pDONR223 0% 77% 72.4% None (many diffs) n/a
5 ccsbBroad304_15210 pLX_304 0% 77% 72.4% V5 (many diffs) n/a
6 TRCN0000474846 GCATACCGGTTGAGACATCATGGT pLX_317 67% 77% 72.4% V5 (many diffs) n/a
Download CSV