Construct: ORF TRCN0000473289
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006635.2_s317c1
- Derived from:
- ccsbBroadEn_15283
- DNA Barcode:
- CTACCAAATCGGTGGACCACAACC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PIKFYVE (200576)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473289
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | NM_152671.3 | 100% | 100% | |
2 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | NM_001178000.1 | 82.2% | 82.2% | 321_611del |
3 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_011510792.3 | 33.6% | 33.5% | (many diffs) |
4 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_011510788.1 | 22.5% | 22.4% | 1346delA;1350_1365del;1371_6003del |
5 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_011510787.1 | 22.4% | 22.3% | (many diffs) |
6 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_011510786.3 | 22.4% | 22.3% | (many diffs) |
7 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_017003570.1 | 22% | 20.6% | (many diffs) |
8 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_011510782.3 | 21.9% | 21.8% | (many diffs) |
9 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | NM_015040.4 | 21.4% | 21.4% | (many diffs) |
10 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_011510780.2 | 21.3% | 21.2% | (many diffs) |
11 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_011510778.3 | 21.3% | 21.2% | (many diffs) |
12 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_011510779.2 | 21.3% | 21.2% | (many diffs) |
13 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_017003568.1 | 21.2% | 21% | (many diffs) |
14 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_011510781.3 | 21% | 20.9% | (many diffs) |
15 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_011510784.2 | 20.8% | 19.5% | (many diffs) |
16 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_011510783.3 | 20.8% | 19.5% | (many diffs) |
17 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_017003569.1 | 20.8% | 19.3% | (many diffs) |
18 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_011510785.3 | 20.6% | 19.2% | (many diffs) |
19 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_011510789.2 | 20% | 19.9% | (many diffs) |
20 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_017003571.1 | 19.4% | 18% | (many diffs) |
21 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_011510790.1 | 11.4% | 11.3% | (many diffs) |
22 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_017003572.1 | 11.4% | 11.3% | (many diffs) |
23 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_017003573.1 | 11.4% | 11.3% | (many diffs) |
24 | human | 200576 | PIKFYVE | phosphoinositide kinase, FY... | XM_017003574.1 | 11.4% | 11.3% | (many diffs) |
25 | mouse | 18711 | Pikfyve | phosphoinositide kinase, FY... | XM_011238454.2 | 29.5% | 30.6% | (many diffs) |
26 | mouse | 18711 | Pikfyve | phosphoinositide kinase, FY... | NM_001310624.1 | 19.7% | 20.5% | (many diffs) |
27 | mouse | 18711 | Pikfyve | phosphoinositide kinase, FY... | XM_006495781.3 | 19.7% | 20.5% | (many diffs) |
28 | mouse | 18711 | Pikfyve | phosphoinositide kinase, FY... | XM_006495779.3 | 19.6% | 20.3% | (many diffs) |
29 | mouse | 18711 | Pikfyve | phosphoinositide kinase, FY... | XM_006495776.3 | 19.6% | 20.3% | (many diffs) |
30 | mouse | 18711 | Pikfyve | phosphoinositide kinase, FY... | XM_006495777.3 | 19.6% | 20.3% | (many diffs) |
31 | mouse | 18711 | Pikfyve | phosphoinositide kinase, FY... | NM_011086.2 | 19.3% | 18.5% | (many diffs) |
32 | mouse | 18711 | Pikfyve | phosphoinositide kinase, FY... | XM_006495782.3 | 19.3% | 18.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1419
- ORF length:
- 1353
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc cacagatgat aagacgtccc caacactgga ctctgctaat gatttgcctc 121 gatctcctac tagtccttct catctcacac actttaaacc tttgactcct gatcaagatg 181 agcccccttt taaatcagct tatagttctt ttgtaaatct ctttcgtttt aacaaagaga 241 gagcagaagg aggccaggga gaacagcagc ctttgagtgg aagttggacc agccctcagc 301 tcccttcgag gacacagtct gttaggtcac ccacacctta taaaaagcag cttaatgagg 361 aactccagcg gcgctcttca gcattaggag acctccgagc ttgcacatat tgtagaaaaa 421 tagccttaag ttatgctcat tccacagaca gtaattctat tggggaagac ttgaatgctc 481 tttcagattc tgcttgctct gtgtctgtgc ttgatccaag tgaaccccga acacctgttg 541 ggagtaggaa agccagccgt aacatatttt tagaggatga tttggcctgg caaagtttga 601 ttcatccaga ttcctcaaat actcctcttt caacaagact tgtatctgtg caagaggatg 661 ctgggaaatc tcctgctcga aatagatcag ccagcattac taacctgtca ctggatagat 721 ctggttctcc tatggtacct tcatatgaga catctgtcag tccccaggct aaccgaacat 781 atgttaggac agagaccact gaggatgaac gcaaaattct tctggacagt gtgcagttaa 841 aagacctgtg gaaaaaaatc tgccatcaca gcagtggaat ggagtttcag gatcaccgct 901 actggttgag aacgcatccc aactgcattg taggaaagga attagtcaac tggctaaTCC 961 GAAATGGGCA TATTGCCACA AGGGCACAAG CTATAGCAAT TGGACAAGCA ATGGTTGATG 1021 GACGTTGGCT GGATTGTGTT AGTCATCACG ACCAGCTTTT CAGAGATGAG TATGCGCTGT 1081 ATAGACCACT GCAGAGTACA GAATTTTCTG AGACGCCTTC TCCCGACAGT GACTCAGTGA 1141 ACTCCGTGGA AGGACACTCT GAGCCATCCT GGTTTAAAGA CATAAAGTTT GATGACAGTG 1201 ACACAGAACA GATAGCTGAA GAAGGTGACG ATAATTTGGC TAATTCTGCC AGTCCTAGCA 1261 AGCGCACATC AGTCAGCAGT TTCCAGTCCA CAGTGGACAG TGACTCAGCC GCTTCTATCA 1321 GCCTGAACGT GGAGCTGGAC AACGTGAACT TCCATATCAA GAAGCCCTCC AAGTACCCAC 1381 ATGTGCCCCC TCACCCTGCT GACCAAAAAG GTAGGAGGTA CCCAACTTCC TTGTACAAAG 1441 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1501 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1561 ACGACTACCA AATCGGTGGA CCACAACCAC GCGTTAAGTC gacaatcaac ctctggatta 1621 caaaatttgt gaaagatt