Transcript: Mouse XM_006495777.3

PREDICTED: Mus musculus phosphoinositide kinase, FYVE finger containing (Pikfyve), transcript variant X2, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Pikfyve (18711)
Length:
9228
CDS:
149..6478

Additional Resources:

NCBI RefSeq record:
XM_006495777.3
NBCI Gene record:
Pikfyve (18711)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001144909 GGGCTGGCATCATAACAACC pXPR_003 TGG 1807 29% 15 0.3945 Pikfyve PIKFYVE 76890
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006495777.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000196671 GTGACGATAATTTGGCTAATT pLKO.1 1635 CDS 100% 13.200 18.480 N PIKFYVE n/a
2 TRCN0000025096 GCCAGTCGTAACATATTCTTA pLKO.1 962 CDS 100% 5.625 7.875 N Pikfyve n/a
3 TRCN0000146583 CGAACATTTACATGGGACAAA pLKO.1 6296 CDS 100% 4.950 6.930 N PIKFYVE n/a
4 TRCN0000025094 GCCCTATTAGACTACCTGAAA pLKO.1 5322 CDS 100% 4.950 6.930 N Pikfyve n/a
5 TRCN0000150081 CGAGTTAAGGAGATCCTAATA pLKO.1 2735 CDS 100% 13.200 10.560 N PIKFYVE n/a
6 TRCN0000361354 TTCGCTATGCCTCCAACATTA pLKO_005 2813 CDS 100% 13.200 10.560 N Pikfyve n/a
7 TRCN0000361355 GTGATTAGAGATGACTATATA pLKO_005 6741 3UTR 100% 15.000 10.500 N Pikfyve n/a
8 TRCN0000025098 GCCACCTCATTATAGACTATT pLKO.1 6213 CDS 100% 13.200 9.240 N Pikfyve n/a
9 TRCN0000025097 CCTTCATCAAAGAGTCCTTAT pLKO.1 1869 CDS 100% 10.800 7.560 N Pikfyve n/a
10 TRCN0000025095 GCCAAGTCTATTCAAGTCTTA pLKO.1 3545 CDS 100% 4.950 3.465 N Pikfyve n/a
11 TRCN0000147783 GCCAAGTCTATTCAAGTCTTA pLKO.1 3545 CDS 100% 4.950 3.465 N PIKFYVE n/a
12 TRCN0000150008 CCTTGGATTGTAACAATGGAA pLKO.1 3896 CDS 100% 3.000 4.200 N PIKFYVE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006495777.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05190 pDONR223 100% 19.6% 20.3% None (many diffs) n/a
2 ccsbBroad304_05190 pLX_304 0% 19.6% 20.3% V5 (many diffs) n/a
3 TRCN0000467001 TATCTTTTAGTCCTAATTAGTTCC pLX_317 31.1% 19.6% 20.3% V5 (many diffs) n/a
4 ccsbBroadEn_15283 pDONR223 0% 19.6% 20.3% None (many diffs) n/a
5 ccsbBroad304_15283 pLX_304 0% 19.6% 20.3% V5 (many diffs) n/a
6 TRCN0000473289 CTACCAAATCGGTGGACCACAACC pLX_317 34.3% 19.6% 20.3% V5 (many diffs) n/a
Download CSV