Transcript: Human XM_017003568.1

PREDICTED: Homo sapiens phosphoinositide kinase, FYVE-type zinc finger containing (PIKFYVE), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIKFYVE (200576)
Length:
9783
CDS:
63..6341

Additional Resources:

NCBI RefSeq record:
XM_017003568.1
NBCI Gene record:
PIKFYVE (200576)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017003568.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150081 CGAGTTAAGGAGATCCTAATA pLKO.1 2595 CDS 100% 13.200 18.480 N PIKFYVE n/a
2 TRCN0000424720 CTAATCCGAAATGGGCATATT pLKO_005 1242 CDS 100% 13.200 18.480 N PIKFYVE n/a
3 TRCN0000197059 GAGATGAGTATGCGCTGTATA pLKO.1 1351 CDS 100% 13.200 18.480 N PIKFYVE n/a
4 TRCN0000146583 CGAACATTTACATGGGACAAA pLKO.1 6159 CDS 100% 4.950 6.930 N PIKFYVE n/a
5 TRCN0000146562 CTTCAGCATTAGACACAAGAA pLKO.1 373 CDS 100% 4.950 6.930 N PIKFYVE n/a
6 TRCN0000025095 GCCAAGTCTATTCAAGTCTTA pLKO.1 3408 CDS 100% 4.950 6.930 N Pikfyve n/a
7 TRCN0000147783 GCCAAGTCTATTCAAGTCTTA pLKO.1 3408 CDS 100% 4.950 6.930 N PIKFYVE n/a
8 TRCN0000195061 CTTACTTGCATACGCTCATAT pLKO.1 7080 3UTR 100% 13.200 9.240 N PIKFYVE n/a
9 TRCN0000419072 GACTATCCTGGCATCACATTT pLKO_005 6695 3UTR 100% 13.200 9.240 N PIKFYVE n/a
10 TRCN0000150008 CCTTGGATTGTAACAATGGAA pLKO.1 3759 CDS 100% 3.000 2.100 N PIKFYVE n/a
11 TRCN0000196586 GCTACAGCAATTAACTTTAAG pLKO.1 6994 3UTR 100% 13.200 7.920 N PIKFYVE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017003568.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05190 pDONR223 100% 21.2% 21% None (many diffs) n/a
2 ccsbBroad304_05190 pLX_304 0% 21.2% 21% V5 (many diffs) n/a
3 TRCN0000467001 TATCTTTTAGTCCTAATTAGTTCC pLX_317 31.1% 21.2% 21% V5 (many diffs) n/a
4 ccsbBroadEn_15283 pDONR223 0% 21.2% 21% None (many diffs) n/a
5 ccsbBroad304_15283 pLX_304 0% 21.2% 21% V5 (many diffs) n/a
6 TRCN0000473289 CTACCAAATCGGTGGACCACAACC pLX_317 34.3% 21.2% 21% V5 (many diffs) n/a
Download CSV