Transcript: Human XM_011510788.1

PREDICTED: Homo sapiens phosphoinositide kinase, FYVE-type zinc finger containing (PIKFYVE), transcript variant X13, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIKFYVE (200576)
Length:
9606
CDS:
159..6164

Additional Resources:

NCBI RefSeq record:
XM_011510788.1
NBCI Gene record:
PIKFYVE (200576)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001148312 CCGAATATGATGTACCATGG pXPR_003 GGG 3541 59% 21 0.9947 PIKFYVE PIKFYVE 76893
2 BRDN0001148075 AGTGCTCACTAGCTCATGTG pXPR_003 AGG 3100 52% 18 0.6163 PIKFYVE PIKFYVE 76891
3 BRDN0001147303 GAAATGGGCATATTGCCACA pXPR_003 AGG 912 15% 7 0.4593 PIKFYVE PIKFYVE 76892
4 BRDN0001144909 GGGCTGGCATCATAACAACC pXPR_003 TGG 1480 25% 12 0.4419 PIKFYVE PIKFYVE 76890
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_011510788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000150081 CGAGTTAAGGAGATCCTAATA pLKO.1 2418 CDS 100% 13.200 18.480 N PIKFYVE n/a
2 TRCN0000424720 CTAATCCGAAATGGGCATATT pLKO_005 1047 CDS 100% 13.200 18.480 N PIKFYVE n/a
3 TRCN0000197059 GAGATGAGTATGCGCTGTATA pLKO.1 1156 CDS 100% 13.200 18.480 N PIKFYVE n/a
4 TRCN0000196671 GTGACGATAATTTGGCTAATT pLKO.1 1318 CDS 100% 13.200 18.480 N PIKFYVE n/a
5 TRCN0000146583 CGAACATTTACATGGGACAAA pLKO.1 5982 CDS 100% 4.950 6.930 N PIKFYVE n/a
6 TRCN0000025095 GCCAAGTCTATTCAAGTCTTA pLKO.1 3231 CDS 100% 4.950 6.930 N Pikfyve n/a
7 TRCN0000147783 GCCAAGTCTATTCAAGTCTTA pLKO.1 3231 CDS 100% 4.950 6.930 N PIKFYVE n/a
8 TRCN0000195061 CTTACTTGCATACGCTCATAT pLKO.1 6903 3UTR 100% 13.200 9.240 N PIKFYVE n/a
9 TRCN0000419072 GACTATCCTGGCATCACATTT pLKO_005 6518 3UTR 100% 13.200 9.240 N PIKFYVE n/a
10 TRCN0000150008 CCTTGGATTGTAACAATGGAA pLKO.1 3582 CDS 100% 3.000 2.100 N PIKFYVE n/a
11 TRCN0000196586 GCTACAGCAATTAACTTTAAG pLKO.1 6817 3UTR 100% 13.200 7.920 N PIKFYVE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_011510788.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05190 pDONR223 100% 22.5% 22.4% None 1346delA;1350_1365del;1371_6003del n/a
2 ccsbBroad304_05190 pLX_304 0% 22.5% 22.4% V5 1346delA;1350_1365del;1371_6003del n/a
3 TRCN0000467001 TATCTTTTAGTCCTAATTAGTTCC pLX_317 31.1% 22.5% 22.4% V5 1346delA;1350_1365del;1371_6003del n/a
4 ccsbBroadEn_15283 pDONR223 0% 22.5% 22.4% None 1346delA;1350_1365del;1371_6003del n/a
5 ccsbBroad304_15283 pLX_304 0% 22.5% 22.4% V5 1346delA;1350_1365del;1371_6003del n/a
6 TRCN0000473289 CTACCAAATCGGTGGACCACAACC pLX_317 34.3% 22.5% 22.4% V5 1346delA;1350_1365del;1371_6003del n/a
Download CSV