Construct: ORF TRCN0000473291
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF007570.1_s317c1
- Derived from:
- BRDN0000398413
- DNA Barcode:
- GAGTCACCCTCAAGGGCGTCCCCA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- DPF1 (8193)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473291
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 8193 | DPF1 | double PHD fingers 1 | NM_001363579.1 | 98.2% | 98.1% | (many diffs) |
| 2 | human | 8193 | DPF1 | double PHD fingers 1 | XM_024451731.1 | 97.7% | 97.6% | (many diffs) |
| 3 | human | 8193 | DPF1 | double PHD fingers 1 | XM_006723407.2 | 95.8% | 95.7% | (many diffs) |
| 4 | human | 8193 | DPF1 | double PHD fingers 1 | XM_006723408.3 | 95.3% | 95.2% | (many diffs) |
| 5 | human | 8193 | DPF1 | double PHD fingers 1 | XM_005259292.5 | 93.3% | 93% | (many diffs) |
| 6 | human | 8193 | DPF1 | double PHD fingers 1 | NM_001135155.2 | 92.5% | 92.5% | (many diffs) |
| 7 | human | 8193 | DPF1 | double PHD fingers 1 | XM_011527357.2 | 91% | 90.7% | (many diffs) |
| 8 | human | 8193 | DPF1 | double PHD fingers 1 | NM_001289978.1 | 90.4% | 90.3% | (many diffs) |
| 9 | human | 8193 | DPF1 | double PHD fingers 1 | XM_005259289.2 | 88.4% | 88.1% | (many diffs) |
| 10 | human | 8193 | DPF1 | double PHD fingers 1 | XM_011527356.1 | 86.3% | 86% | (many diffs) |
| 11 | human | 8193 | DPF1 | double PHD fingers 1 | NM_001135156.2 | 85% | 85% | (many diffs) |
| 12 | human | 8193 | DPF1 | double PHD fingers 1 | XM_011527358.2 | 82.9% | 82.8% | (many diffs) |
| 13 | human | 8193 | DPF1 | double PHD fingers 1 | NM_004647.3 | 80% | 79.7% | (many diffs) |
| 14 | human | 8193 | DPF1 | double PHD fingers 1 | XM_006723409.2 | 57.7% | 48.5% | (many diffs) |
| 15 | human | 8193 | DPF1 | double PHD fingers 1 | XM_006723410.2 | 57.7% | 48.5% | (many diffs) |
| 16 | human | 8193 | DPF1 | double PHD fingers 1 | XR_243964.2 | 46.5% | (many diffs) | |
| 17 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | NM_013874.2 | 92% | 96.9% | (many diffs) |
| 18 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_006540041.2 | 88.6% | 92.2% | (many diffs) |
| 19 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_006540039.2 | 87.9% | 92.9% | (many diffs) |
| 20 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_006540038.3 | 86.9% | 91.5% | (many diffs) |
| 21 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_006540035.3 | 84.9% | 89.3% | (many diffs) |
| 22 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_006540034.3 | 84.7% | 88.9% | (many diffs) |
| 23 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_006540032.2 | 81.6% | 86% | (many diffs) |
| 24 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_011250588.1 | 74.1% | 77% | (many diffs) |
| 25 | mouse | 29861 | Dpf1 | D4, zinc and double PHD fin... | XM_011250589.1 | 70.3% | 74.5% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 69
- ORF end:
- 1224
- ORF length:
- 1155
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcaccat ggccacggtc atccccagcc ccctgagcct aggcgaggac ttctaccgcg 121 aggccatcga gcactgccgc agttacaacg cgcgcctgtg cgccgagcgc agcctgcgac 181 tgcccttcct cgactcgcag accggcgtgg cccagaacaa ctgctacatc tggatggaga 241 agacccaccg cgggccgggt ttggccccgg gacagattta cacgtacccc gcccgctgtt 301 ggaggaagaa acggagactc aacatcctgg aggaccccag actcaggccc tgcgagtaca 361 agatcgactg tgaagcaccc ctgaagaagg agggtggcct cccggaaggg ccggtcctcg 421 aggctctact gtgtgcagag acgggggaga agaagattga gctgaaggag gaggagacca 481 ttatggactg tcagaaacag cagttgctgg agtttccgca tgacctcgag gtggaagact 541 tggaggatga cattcccagg aggaagaaca gggccaaagg aaaggcatat ggcatcgggg 601 gtctccggaa acgccaggac accgcttccc tggaggaccg agacaagccg tatgtctgtg 661 atatctgtgg gaaacggtat aagaaccggc cggggctcag ctaccactac acccacaccc 721 acctggccga ggaggagggg gaggagaacg ccgaacgcca cgccctgccc ttccaccgga 781 aaaacaacca taaacagttt tacaaagaat tggcctgggt ccctgaggca caaaggaaac 841 acacagccaa gaaggtgccc acggtcatcc ccaacggcta ctgtgacttc tgccTGGGGG 901 GCTCCAAGAA GACGGGGTGT CCCGAGGACC TCATCTCCTG TGCGGACTGT GGGCGATCAG 961 GACACCCCTC GTGTTTACAA TTCACGGTGA ACATGACGGC AGCCGTGCGG ACCTACCGCT 1021 GGCAGTGCAT CGAGTGCAAA TCCTGCAGCC TGTGCGGAAC CTCCGAGAAC GACGACCAGC 1081 TGCTGTTTTG TGATGACTGC GATCGGGGTT ACCACATGTA CTGCCTGAGT CCCCCCATGG 1141 CGGAGCCCCC GGAAGGGAGC TGGAGCTGTC ACCTCTGTCT CCGGCACCTG AAGGAAAAGG 1201 CTTCTGCTTA CATCACCCTC ACCTTGCCAA CTTTCTTGTA CAAAGTGGTT GATATCGGTA 1261 AGCCTATCCC TAACCCTCTC CTCGGTCTCG ATTCTACGTA GTAATGAACT AGTCCGTAAC 1321 TTGAAAGTAT TTCGATTTCT TGGCTTTATA TATCTTGTGG AAAGGACGAG AGTCACCCTC 1381 AAGGGCGTCC CCAACGCGTT AAGTCgacaa tcaacctctg gattacaaaa tttgtgaaag 1441 att