Construct: ORF TRCN0000473306
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF009834.1_s317c1
- Derived from:
- ccsbBroadEn_01768
- DNA Barcode:
- CCACGAAAACAAATTTCGGGTACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- VEGFA (7422)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473306
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001171628.1 | 100% | 100% | |
| 2 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001171630.1 | 93.1% | 93.1% | 392_393ins30 |
| 3 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001204384.1 | 85.9% | 85.9% | 423_494del |
| 4 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001171627.1 | 82.6% | 81.6% | (many diffs) |
| 5 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001171626.1 | 76.9% | 76.4% | 423_554del |
| 6 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001171629.1 | 75.3% | 74.3% | (many diffs) |
| 7 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001317010.1 | 69% | 76.4% | 423_554del;574_639del |
| 8 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001171625.1 | 68.5% | 70.3% | (many diffs) |
| 9 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001171624.1 | 66.6% | 65.8% | (many diffs) |
| 10 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001287044.2 | 62.3% | 61.7% | 0_1ins84;339_470del |
| 11 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001171623.1 | 61.7% | 61.1% | (many diffs) |
| 12 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001025370.3 | 44.9% | 44.9% | 1_540del |
| 13 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001171622.2 | 41.8% | 41.8% | 1_540del;932_933ins30 |
| 14 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001204385.2 | 41.8% | 41.8% | 1_540del;963_1034del |
| 15 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001025369.3 | 40.8% | 40.1% | (many diffs) |
| 16 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001025368.3 | 39.6% | 39.3% | 1_540del;963_1094del |
| 17 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001033756.3 | 38.9% | 38.2% | (many diffs) |
| 18 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001025367.3 | 36.9% | 37.7% | (many diffs) |
| 19 | human | 7422 | VEGFA | vascular endothelial growth... | NM_003376.6 | 36.3% | 36% | (many diffs) |
| 20 | human | 7422 | VEGFA | vascular endothelial growth... | NM_001025366.3 | 34.8% | 34.5% | (many diffs) |
| 21 | mouse | 22339 | Vegfa | vascular endothelial growth... | NM_001287058.1 | 87.8% | 87.7% | (many diffs) |
| 22 | mouse | 22339 | Vegfa | vascular endothelial growth... | NM_001287057.1 | 66.5% | 67% | (many diffs) |
| 23 | mouse | 22339 | Vegfa | vascular endothelial growth... | NM_001317041.1 | 59.4% | 67% | (many diffs) |
| 24 | mouse | 22339 | Vegfa | vascular endothelial growth... | NM_001287056.1 | 58.6% | 57.6% | (many diffs) |
| 25 | mouse | 22339 | Vegfa | vascular endothelial growth... | NM_001025257.3 | 39.8% | 39.6% | (many diffs) |
| 26 | mouse | 22339 | Vegfa | vascular endothelial growth... | NM_009505.4 | 34.6% | 34.6% | (many diffs) |
| 27 | mouse | 22339 | Vegfa | vascular endothelial growth... | NM_001025250.3 | 32.2% | 31.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 507
- ORF length:
- 441
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa ctttctgctg tcttgggtgc attggagcct tgccttgctg ctctacctcc 121 accatgccaa gtggtcccag gctgcaccca tggcagaagg aggagggcag aatcatcacg 181 aagtggtgaa gttcatggat gtctatcagc gcagctactg ccatccaatc gagaccctgg 241 tggacatctt ccaggagtac cctgatgaga tcgagtacat cttcaagcca tcctgtgtgc 301 cccTGATGCG ATGCGGGGGC TGCTGCAATG ACGAGGGCCT GGAGTGTGTG CCCACTGAGG 361 AGTCCAACAT CACCATGCAG ATTATGCGGA TCAAACCTCA CCAAGGCCAG CACATAGGAG 421 AGATGAGCTT CCTACAGCAC AACAAATGTG AATGCAGACC AAAGAAAGAT AGAGCAAGAC 481 AAGAAAAATG TGACAAGCCG AGGCGGTGCC CAACTTTCTT GTACAAAGTG GTTGATATCG 541 GTAAGCCTAT CCCTAACCCT CTCCTCGGTC TCGATTCTAC GTAGTAATGA ACTAGTCCGT 601 AACTTGAAAG TATTTCGATT TCTTGGCTTT ATATATCTTG TGGAAAGGAC GACCACGAAA 661 ACAAATTTCG GGTACAACGC GTTAAGTCga caatcaacct ctggattaca aaatttgtga 721 aagatt