Transcript: Human NM_001171628.1

Homo sapiens vascular endothelial growth factor A (VEGFA), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
VEGFA (7422)
Length:
3422
CDS:
1039..1482

Additional Resources:

NCBI RefSeq record:
NM_001171628.1
NBCI Gene record:
VEGFA (7422)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001171628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315233 TCGACAGAACAGTCCTTAATC pLKO_005 1599 3UTR 100% 13.200 18.480 N VEGFA n/a
2 TRCN0000003343 AGGGCAGAATCATCACGAAGT pLKO.1 1137 CDS 100% 4.050 3.240 N VEGFA n/a
3 TRCN0000315231 TGCAGATTATGCGGATCAAAC pLKO_005 1349 CDS 100% 10.800 7.560 N VEGFA n/a
4 TRCN0000003347 ATGCGGATCAAACCTCACCAA pLKO.1 1357 CDS 100% 2.640 1.848 N VEGFA n/a
5 TRCN0000066821 TGCGGATCAAACCTCACCAAA pLKO.1 1358 CDS 100% 4.950 3.465 N Vegfa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001171628.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_01768 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_01768 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000473306 CCACGAAAACAAATTTCGGGTACA pLX_317 46.4% 100% 100% V5 n/a
4 TRCN0000488030 GCCACGGGCGGCCTGACTAAAACC pLX_317 57.9% 76.7% 76.4% V5 (not translated due to prior stop codon) 168G>A;422_423ins132 n/a
5 TRCN0000489373 TTTGAGGCAAATACCATAACCAAT pLX_317 57.7% 76.6% 76% V5 168G>A;422_423ins132;441_442insG n/a
Download CSV