Transcript: Human NM_001287044.2

Homo sapiens vascular endothelial growth factor A (VEGFA), transcript variant 10, mRNA.

Source:
NCBI, updated 2019-06-26
Taxon:
Homo sapiens (human)
Gene:
VEGFA (7422)
Length:
2569
CDS:
153..644

Additional Resources:

NCBI RefSeq record:
NM_001287044.2
NBCI Gene record:
VEGFA (7422)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001287044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310985 CAAGATCCGCAGACGTGTAAA pLKO_005 534 CDS 100% 13.200 18.480 N Vegfa n/a
2 TRCN0000315213 CAAGATCCGCAGACGTGTAAA pLKO_005 534 CDS 100% 13.200 18.480 N VEGFA n/a
3 TRCN0000315233 TCGACAGAACAGTCCTTAATC pLKO_005 761 3UTR 100% 13.200 18.480 N VEGFA n/a
4 TRCN0000003344 CGAACGTACTTGCAGATGTGA pLKO.1 608 CDS 100% 3.000 4.200 N VEGFA n/a
5 TRCN0000003346 GACGTGTAAATGTTCCTGCAA pLKO.1 545 CDS 100% 2.640 3.696 N VEGFA n/a
6 TRCN0000003343 AGGGCAGAATCATCACGAAGT pLKO.1 167 CDS 100% 4.050 3.240 N VEGFA n/a
7 TRCN0000315232 AGGCGAGGCAGCTTGAGTTAA pLKO_005 586 CDS 100% 13.200 9.240 N VEGFA n/a
8 TRCN0000315231 TGCAGATTATGCGGATCAAAC pLKO_005 379 CDS 100% 10.800 7.560 N VEGFA n/a
9 TRCN0000066820 GAGCGGAGAAAGCATTTGTTT pLKO.1 510 CDS 100% 5.625 3.938 N Vegfa n/a
10 TRCN0000315978 GAGCGGAGAAAGCATTTGTTT pLKO_005 510 CDS 100% 5.625 3.938 N Vegfa n/a
11 TRCN0000003347 ATGCGGATCAAACCTCACCAA pLKO.1 387 CDS 100% 2.640 1.848 N VEGFA n/a
12 TRCN0000066821 TGCGGATCAAACCTCACCAAA pLKO.1 388 CDS 100% 4.950 3.465 N Vegfa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001287044.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488030 GCCACGGGCGGCCTGACTAAAACC pLX_317 57.9% 85.1% 85.3% V5 (not translated due to prior stop codon) 0_1ins84;84G>A n/a
2 TRCN0000489373 TTTGAGGCAAATACCATAACCAAT pLX_317 57.7% 85% 84.8% V5 0_1ins84;84G>A;489_490insG n/a
3 ccsbBroadEn_01768 pDONR223 100% 62.3% 61.7% None 0_1ins84;339_470del n/a
4 ccsbBroad304_01768 pLX_304 0% 62.3% 61.7% V5 0_1ins84;339_470del n/a
5 TRCN0000473306 CCACGAAAACAAATTTCGGGTACA pLX_317 46.4% 62.3% 61.7% V5 0_1ins84;339_470del n/a
Download CSV