Transcript: Mouse NM_001025250.3

Mus musculus vascular endothelial growth factor A (Vegfa), transcript variant 1, mRNA.

Source:
NCBI, updated 2017-06-26
Taxon:
Mus musculus (mouse)
Gene:
Vegfa (22339)
Length:
3547
CDS:
488..1666

Additional Resources:

NCBI RefSeq record:
NM_001025250.3
NBCI Gene record:
Vegfa (22339)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001025250.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000304451 TCACCGGAAAGACCGATTAAC pLKO_005 1716 3UTR 100% 13.200 18.480 N Vegfa n/a
2 TRCN0000066821 TGCGGATCAAACCTCACCAAA pLKO.1 1338 CDS 100% 4.950 6.930 N Vegfa n/a
3 TRCN0000003347 ATGCGGATCAAACCTCACCAA pLKO.1 1337 CDS 100% 2.640 3.696 N VEGFA n/a
4 TRCN0000003346 GACGTGTAAATGTTCCTGCAA pLKO.1 1567 CDS 100% 2.640 3.696 N VEGFA n/a
5 TRCN0000310985 CAAGATCCGCAGACGTGTAAA pLKO_005 1556 CDS 100% 13.200 10.560 N Vegfa n/a
6 TRCN0000315213 CAAGATCCGCAGACGTGTAAA pLKO_005 1556 CDS 100% 13.200 10.560 N VEGFA n/a
7 TRCN0000315232 AGGCGAGGCAGCTTGAGTTAA pLKO_005 1608 CDS 100% 13.200 9.240 N VEGFA n/a
8 TRCN0000066820 GAGCGGAGAAAGCATTTGTTT pLKO.1 1532 CDS 100% 5.625 3.938 N Vegfa n/a
9 TRCN0000315978 GAGCGGAGAAAGCATTTGTTT pLKO_005 1532 CDS 100% 5.625 3.938 N Vegfa n/a
10 TRCN0000066818 CGAGATAGAGTACATCTTCAA pLKO.1 1219 CDS 100% 4.950 3.465 N Vegfa n/a
11 TRCN0000316047 CGAGATAGAGTACATCTTCAA pLKO_005 1219 CDS 100% 4.950 3.465 N Vegfa n/a
12 TRCN0000066822 GATCAAGTTCATGGATGTCTA pLKO.1 1138 CDS 100% 4.950 3.465 N Vegfa n/a
13 TRCN0000316046 GATCAAGTTCATGGATGTCTA pLKO_005 1138 CDS 100% 4.950 3.465 N Vegfa n/a
14 TRCN0000003344 CGAACGTACTTGCAGATGTGA pLKO.1 1630 CDS 100% 3.000 2.100 N VEGFA n/a
15 TRCN0000066819 GCAGACCAAAGAAAGACAGAA pLKO.1 1407 CDS 100% 4.950 2.970 N Vegfa n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001025250.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488030 GCCACGGGCGGCCTGACTAAAACC pLX_317 57.9% 44% 43.2% V5 (not translated due to prior stop codon) (many diffs) n/a
2 TRCN0000489373 TTTGAGGCAAATACCATAACCAAT pLX_317 57.7% 44% 43.1% V5 (many diffs) n/a
3 ccsbBroadEn_01768 pDONR223 100% 32.2% 31.6% None (many diffs) n/a
4 ccsbBroad304_01768 pLX_304 0% 32.2% 31.6% V5 (many diffs) n/a
5 TRCN0000473306 CCACGAAAACAAATTTCGGGTACA pLX_317 46.4% 32.2% 31.6% V5 (many diffs) n/a
Download CSV