Construct: ORF TRCN0000473321
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003754.1_s317c1
- Derived from:
- ccsbBroadEn_11942
- DNA Barcode:
- ATACTAGCCTTCTCAAACGCGGCT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- THAP4 (51078)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473321
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 51078 | THAP4 | THAP domain containing 4 | NM_001164356.1 | 65.3% | 65% | 1_1delAins250;3_4insTCGCCCAGCCGC |
2 | human | 51078 | THAP4 | THAP domain containing 4 | NM_015963.6 | 43.6% | 43.6% | 1_975del |
3 | human | 51078 | THAP4 | THAP domain containing 4 | XM_017004256.1 | 41.9% | 41.9% | 1_1047del |
4 | human | 51078 | THAP4 | THAP domain containing 4 | XM_011511291.2 | 40.1% | 40.1% | 1_1047del;1685_1765del |
5 | human | 51078 | THAP4 | THAP domain containing 4 | XM_005247016.4 | 35.4% | 35.4% | 1_1296del;1934_2014del |
6 | mouse | 67026 | Thap4 | THAP domain containing 4 | NM_001310761.1 | 58.3% | 60.7% | (many diffs) |
7 | mouse | 67026 | Thap4 | THAP domain containing 4 | NM_025920.3 | 39.6% | 40.9% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 822
- ORF length:
- 756
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc catcaacgag gtcatcctgt cggcgtcagg ggcctgcaag ctcatcgact 121 cactgcactc ctactgcttc tcctcccggc agaacaagag ccaggtgtgc tgcctgcggg 181 agcaggtgga gaagaagaac ggcgagctga agagcctgcg gcagagggtc agccgctccg 241 acagccaggt gcggaagcta caggagaagc tggatgagct gaggagagtg agcgtcccct 301 atccaagtag cctgctgtcg cccagccgcg agccccccaa gatgaaccca gtggtggagc 361 cactgtcctg gatgctgggc acctggctgt cggacccacc tGGAGCCGGG ACCTACCCCA 421 CACTGCAGCC CTTCCAGTAC CTGGAGGAGG TTCACATCTC CCACGTGGGC CAGCCCATGC 481 TGAACTTCTC GTTCAACTCC TTCCACCCGG ACACGCGCAA GCCGATGCAC AGAGAGTGTG 541 GCTTCATTCG CCTCAAGCCC GACACCAACA AGGTGGCCTT TGTCAGCGCC CAGAACACAG 601 GCGTGGTGGA AGTGGAGGAG GGCGAGGTGA ACGGGCAGGA GCTGTGCATC GCATCCCACT 661 CCATCGCCAG GATCTCCTTC GCCAAGGAGC CCCACGTAGA GCAGATCACC CGGAAGTTCA 721 GGCTGAATTC TGAAGGCAAA CTTGAGCAGA CGGTCTCCAT GGCAACCACG ACACAGCCAA 781 TGACTCAGCA TCTTCACGTC ACCTACAAGA AGGTGACCCC GTACCCAACT TTCTTGTACA 841 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 901 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 961 AGGACGAATA CTAGCCTTCT CAAACGCGGC TACGCGTTAA GTCgacaatc aacctctgga 1021 ttacaaaatt tgtgaaagat t