Transcript: Human XM_005247016.4

PREDICTED: Homo sapiens THAP domain containing 4 (THAP4), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
THAP4 (51078)
Length:
2542
CDS:
206..2341

Additional Resources:

NCBI RefSeq record:
XM_005247016.4
NBCI Gene record:
THAP4 (51078)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_005247016.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413365 ACGTCTAATCCAATGGTTAAA pLKO_005 625 CDS 100% 13.200 18.480 N THAP4 n/a
2 TRCN0000445895 CATCTTCCACCTGACCGAGAA pLKO_005 775 CDS 100% 4.050 5.670 N THAP4 n/a
3 TRCN0000137380 GCGTGCAAATTTATCGGCTCA pLKO.1 1208 CDS 100% 2.160 3.024 N THAP4 n/a
4 TRCN0000136611 CACAGAGAGTGTGGCTTCATT pLKO.1 1964 CDS 100% 5.625 3.938 N THAP4 n/a
5 TRCN0000134839 CAGATAAGAGTGGCATTTCTA pLKO.1 1158 CDS 100% 5.625 3.938 N THAP4 n/a
6 TRCN0000134712 GACTCCCACTAAGTATTCATT pLKO.1 667 CDS 100% 5.625 3.938 N THAP4 n/a
7 TRCN0000134021 CATTTCTCTGTAGTGAGCATT pLKO.1 684 CDS 100% 4.950 3.465 N THAP4 n/a
8 TRCN0000438062 GTGTGGCTTCATTCGCCTCAA pLKO_005 1972 CDS 100% 4.050 2.835 N THAP4 n/a
9 TRCN0000135708 GTACAGTTTCTCCTCTAAGCA pLKO.1 1237 CDS 100% 3.000 2.100 N THAP4 n/a
10 TRCN0000135441 GCATTTCACCAAAGACAGCTT pLKO.1 700 CDS 100% 2.640 1.848 N THAP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_005247016.4, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11942 pDONR223 100% 35.4% 35.4% None 1_1296del;1934_2014del n/a
2 ccsbBroad304_11942 pLX_304 0% 35.4% 35.4% V5 1_1296del;1934_2014del n/a
3 TRCN0000473321 ATACTAGCCTTCTCAAACGCGGCT pLX_317 55.5% 35.4% 35.4% V5 1_1296del;1934_2014del n/a
4 ccsbBroadEn_11943 pDONR223 100% 23.5% 23.2% None (many diffs) n/a
5 ccsbBroad304_11943 pLX_304 0% 23.5% 23.2% V5 (many diffs) n/a
6 TRCN0000466277 ACCACGTATTGTGGCGGGGTTCAA pLX_317 69.6% 23.5% 23.2% V5 (many diffs) n/a
Download CSV