Transcript: Human XM_017004256.1

PREDICTED: Homo sapiens THAP domain containing 4 (THAP4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
THAP4 (51078)
Length:
2022
CDS:
16..1821

Additional Resources:

NCBI RefSeq record:
XM_017004256.1
NBCI Gene record:
THAP4 (51078)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017004256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413365 ACGTCTAATCCAATGGTTAAA pLKO_005 186 CDS 100% 13.200 18.480 N THAP4 n/a
2 TRCN0000445895 CATCTTCCACCTGACCGAGAA pLKO_005 336 CDS 100% 4.050 5.670 N THAP4 n/a
3 TRCN0000137380 GCGTGCAAATTTATCGGCTCA pLKO.1 769 CDS 100% 2.160 3.024 N THAP4 n/a
4 TRCN0000136611 CACAGAGAGTGTGGCTTCATT pLKO.1 1525 CDS 100% 5.625 3.938 N THAP4 n/a
5 TRCN0000134839 CAGATAAGAGTGGCATTTCTA pLKO.1 719 CDS 100% 5.625 3.938 N THAP4 n/a
6 TRCN0000134712 GACTCCCACTAAGTATTCATT pLKO.1 228 CDS 100% 5.625 3.938 N THAP4 n/a
7 TRCN0000134021 CATTTCTCTGTAGTGAGCATT pLKO.1 245 CDS 100% 4.950 3.465 N THAP4 n/a
8 TRCN0000438062 GTGTGGCTTCATTCGCCTCAA pLKO_005 1533 CDS 100% 4.050 2.835 N THAP4 n/a
9 TRCN0000135708 GTACAGTTTCTCCTCTAAGCA pLKO.1 798 CDS 100% 3.000 2.100 N THAP4 n/a
10 TRCN0000135441 GCATTTCACCAAAGACAGCTT pLKO.1 261 CDS 100% 2.640 1.848 N THAP4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017004256.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11942 pDONR223 100% 41.9% 41.9% None 1_1047del n/a
2 ccsbBroad304_11942 pLX_304 0% 41.9% 41.9% V5 1_1047del n/a
3 TRCN0000473321 ATACTAGCCTTCTCAAACGCGGCT pLX_317 55.5% 41.9% 41.9% V5 1_1047del n/a
4 ccsbBroadEn_11943 pDONR223 100% 27.8% 27.4% None (many diffs) n/a
5 ccsbBroad304_11943 pLX_304 0% 27.8% 27.4% V5 (many diffs) n/a
6 TRCN0000466277 ACCACGTATTGTGGCGGGGTTCAA pLX_317 69.6% 27.8% 27.4% V5 (many diffs) n/a
Download CSV