Construct: ORF TRCN0000473407
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013817.2_s317c1
- Derived from:
- ccsbBroadEn_14747
- DNA Barcode:
- TGCATTCACACTTTGGTCATCTTG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PFKP (5214)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473407
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_002627.5 | 99.8% | 100% | 483G>A;1281A>G;1794C>T |
| 2 | human | 5214 | PFKP | phosphofructokinase, platelet | XM_005252466.4 | 96.7% | 96.5% | (many diffs) |
| 3 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323067.1 | 96.1% | 95.4% | (many diffs) |
| 4 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323071.2 | 95% | 95.1% | (many diffs) |
| 5 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323072.1 | 95% | 95.1% | (many diffs) |
| 6 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001345944.1 | 95% | 95.1% | (many diffs) |
| 7 | human | 5214 | PFKP | phosphofructokinase, platelet | XM_024448038.1 | 95% | 95.1% | (many diffs) |
| 8 | human | 5214 | PFKP | phosphofructokinase, platelet | XM_005252465.4 | 93.7% | 93.8% | (many diffs) |
| 9 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323068.2 | 93.3% | 93.4% | (many diffs) |
| 10 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001242339.1 | 92.1% | 85.9% | (many diffs) |
| 11 | human | 5214 | PFKP | phosphofructokinase, platelet | XM_006717449.1 | 89.2% | 89.3% | (many diffs) |
| 12 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323069.2 | 78.3% | 78.4% | 0_1ins507;774A>G;1287C>T |
| 13 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323073.1 | 72.3% | 72.4% | 0_1ins648;633A>G;1146C>T |
| 14 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323074.1 | 72.3% | 72.4% | 0_1ins648;633A>G;1146C>T |
| 15 | human | 5214 | PFKP | phosphofructokinase, platelet | NM_001323070.1 | 65.8% | 65.9% | (many diffs) |
| 16 | mouse | 56421 | Pfkp | phosphofructokinase, platelet | NM_019703.4 | 82.1% | 88.2% | (many diffs) |
| 17 | mouse | 56421 | Pfkp | phosphofructokinase, platelet | NM_001291071.1 | 80.1% | 85.8% | (many diffs) |
| 18 | mouse | 56421 | Pfkp | phosphofructokinase, platelet | XM_006516487.3 | 76.2% | 82% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 2418
- ORF length:
- 2352
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgga cgcggacgac tcccgggccc ccaagggctc cttgcggaag ttcctggagc 121 acctctccgg ggccggcaag gccatcggcg tgctgaccag cggcggggat gctcaaggta 181 tgaacgctgc cgtccgtgcc gtggtgcgca tgggtatcta cgtgggggcc aaggtgtact 241 tcatctacga gggctaccag ggcatggtgg acggaggctc aaacatcgca gaggccgact 301 gggagagtgt ctccagcatc ctgcaagtgg gcgggacgat cattggcagt gcgcggtgcc 361 aggccttccg cacgcgggaa ggccgcctga aggctgcttg caacctgctg cagcgcggca 421 tcaccaacct gtgtgtgatc ggcggggacg ggagcctcac cggggccaac ctcttccgga 481 aggagtggag tgggctgctg gaggagctgg ccaggaacgg ccagatcgat aaggaggccg 541 tgcagaaata cgcctacctc aacgtggtgg gcatggtggg ctccatcgac aatgatttct 601 gcggcaccga catgaccatc ggcacggact ccgccctgca caggatcatc gaggtcgtcg 661 acgccatcat gaccacggcc cagagccacc agaggacctt cgttctggag gtgatgggac 721 gacactgtgg gtacctggcc ctggtgagtg ccttggcctg cggtgcggac tgggtgttcc 781 ttccagaatc tccaccagag gaaggctggg aggagcagat gtgtgtcaaa ctctcggaga 841 accgtgcccg gaaaaaaagg ctgaatatta ttattgtggc tgaaggagca attgataccc 901 aaaataaacc catcacctct gagaaaatca aagagcttgt cgtcacgcag ctgggctatg 961 acacacgtgt gaccatcctc gggcacgtgc agagaggagg gaccccttcg gcattcgaca 1021 ggatcttggc cagccgcatg ggagtggagg cagtcatcgc cttgctagag gccaccccgg 1081 acaccccagc ttgcgtcgtg tcactgaacg ggaaccacgc cgtgcgcctg ccgctgatgg 1141 agtgcgtgca gatgactcag gatgtgcaga aggcgatgga cgagaggaga tttcaagatg 1201 cggttcgact ccgagggagg agctttgcgg gcaacctgaa cacctacaag cgacttgcca 1261 tcaagctgcc ggatgatcag atcccaaaga ccaattgcaa cgtagctgtc atcaacgtgg 1321 gggcacccgc ggctgggatg aacgcggccg tacgctcagc tgtgcgcgtg ggcattgccg 1381 acggccacag gatgctcgcc atctatgatg gctttgacgg cttcgccaag ggccagatca 1441 aagaaatcgg ctggacagat gtcgggggct ggaccggcca aggaggctcc attcttggga 1501 caaaacgcgt tctcccgggg aagtacttgg aagagatcgc cacacagatg cgcacgcaca 1561 gcatcaacgc gctgctgatc atcggtggat tcgaggccta cctgggactc ctggagctgt 1621 cagccgcccg ggagaagcac gaggagttct gtgtccccat ggtcatggtt cccgctactg 1681 tgtccaacaa tgtgccgggt tccgatttca gcatcggggc agacaccgcc ctgaacacta 1741 tcaccgacac ctgcgaccgc atcaagcagt ccgccagcgg aaccaagcgg cgcgtgttca 1801 tcatcgagac catgggcggc tactgtggct acctggccaa catggggggg ctcgcggctg 1861 gagctgatgc cgcatacatt ttcgaagagc ccttcgacat cagggatctg cagtccaacg 1921 tggagcacct gacggagaaa atgaagacca ccatccagag aggccttGTG CTCAGAAATG 1981 AGAGCTGCAG TGAAAACTAC ACCACCGACT TCATTTACCA GCTGTATTCA GAAGAGGGCA 2041 AAGGCGTGTT TGACTGCAGG AAGAACGTGC TGGGTCACAT GCAGCAGGGT GGGGCACCCT 2101 CTCCATTTGA TAGAAACTTT GGAACCAAAA TCTCTGCCAG AGCTATGGAG TGGATCACTG 2161 CAAAACTCAA GGAGGCCCGG GGCAGAGGAA AAAAATTTAC CACCGATGAT TCCATTTGTG 2221 TGCTGGGAAT AAGCAAAAGA AACGTTATTT TTCAACCTGT GGCAGAGCTG AAGAAGCAAA 2281 CGGATTTTGA GCACAGGATT CCCAAAGAAC AGTGGTGGCT CAAGCTACGG CCCCTCATGA 2341 AAATCCTGGC CAAGTACAAG GCCAGCTATG ACGTGTCGGA CTCAGGCCAG CTGGAACATG 2401 TGCAGCCCTG GAGTGTCTGC CCAACTTTCT TGTACAAAGT GGTTGATATC GGTAAGCCTA 2461 TCCCTAACCC TCTCCTCGGT CTCGATTCTA CGTAGTAATG AACTAGTCCG TAACTTGAAA 2521 GTATTTCGAT TTCTTGGCTT TATATATCTT GTGGAAAGGA CGATGCATTC ACACTTTGGT 2581 CATCTTGACG CGTTAAGTCg acaatcaacc tctggattac aaaatttgtg aaagatt