Transcript: Human NM_002627.5

Homo sapiens phosphofructokinase, platelet (PFKP), transcript variant 1, mRNA.

Source:
NCBI, updated 2019-09-27
Taxon:
Homo sapiens (human)
Gene:
PFKP (5214)
Length:
2626
CDS:
49..2403

Additional Resources:

NCBI RefSeq record:
NM_002627.5
NBCI Gene record:
PFKP (5214)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001146136 GAAGTACGCCTACCTCAACG pXPR_003 TGG 496 21% 5 0.3643 PFKP PFKP 77626
2 BRDN0001147171 GCCGGATGATCAGATCCCAA pXPR_003 AGG 1219 52% 12 0.2991 PFKP PFKP 77628
3 BRDN0001145208 GATGTGTGTCAAACTCTCGG pXPR_003 AGG 769 33% 7 0.2987 PFKP PFKP 77627
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_002627.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195199 CAGCACTTTATGCACGTATTA pLKO.1 2474 3UTR 100% 13.200 18.480 N PFKP n/a
2 TRCN0000037778 CCCGCTACTGTGTCCAACAAT pLKO.1 1654 CDS 100% 5.625 7.875 N PFKP n/a
3 TRCN0000037777 CTGAACACCTACAAGCGACTT pLKO.1 1219 CDS 100% 4.050 5.670 N PFKP n/a
4 TRCN0000289009 CTGAACACCTACAAGCGACTT pLKO_005 1219 CDS 100% 4.050 5.670 N PFKP n/a
5 TRCN0000037775 GCTGAAGAAGCAAACGGATTT pLKO.1 2250 CDS 100% 10.800 7.560 N PFKP n/a
6 TRCN0000289060 GCTGAAGAAGCAAACGGATTT pLKO_005 2250 CDS 100% 10.800 7.560 N PFKP n/a
7 TRCN0000199302 CCACCGATGATTCCATTTGTG pLKO.1 2183 CDS 100% 4.950 3.465 N PFKP n/a
8 TRCN0000199329 CGAGAGGAGATTTCAAGATGC pLKO.1 1164 CDS 100% 4.050 2.835 N PFKP n/a
9 TRCN0000310258 CGAGAGGAGATTTCAAGATGC pLKO_005 1164 CDS 100% 4.050 2.835 N PFKP n/a
10 TRCN0000037774 CGTGTTCATCATCGAGACCAT pLKO.1 1776 CDS 100% 2.640 1.848 N PFKP n/a
11 TRCN0000199163 CGTGCAGAAGTACGCCTACCT pLKO.1 522 CDS 100% 0.880 0.616 N PFKP n/a
12 TRCN0000037776 CTCGCCATCTATGATGGCTTT pLKO.1 1378 CDS 100% 0.405 0.284 N PFKP n/a
13 TRCN0000289061 CTCGCCATCTATGATGGCTTT pLKO_005 1378 CDS 100% 0.405 0.284 N PFKP n/a
14 TRCN0000199162 CCGGAGCTGATGCCGCATACA pLKO.1 1841 CDS 100% 0.000 0.000 N PFKP n/a
15 TRCN0000199816 GCCAACCTCTTCCGGAAGGAG pLKO.1 448 CDS 100% 0.000 0.000 N PFKP n/a
16 TRCN0000296100 GCCAACCTCTTCCGGAAGGAG pLKO_005 448 CDS 100% 0.000 0.000 N PFKP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_002627.5, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06717 pDONR223 100% 99.9% 100% None 1281A>G n/a
2 ccsbBroad304_06717 pLX_304 0% 99.9% 100% V5 1281A>G n/a
3 TRCN0000467766 TGCTGACACAGTGGCGCTGTTTGC pLX_317 19.2% 99.9% 100% V5 1281A>G n/a
4 TRCN0000488232 TGCTCTAAATTATAAATGATCATC pLX_317 13% 99.9% 100% V5 (not translated due to prior stop codon) 1281A>G n/a
5 ccsbBroadEn_15527 pDONR223 0% 99.8% 100% None 483G>A;1281A>G;1794C>T n/a
6 ccsbBroad304_15527 pLX_304 0% 99.8% 100% V5 483G>A;1281A>G;1794C>T n/a
7 ccsbBroadEn_14747 pDONR223 0% 99.8% 100% None 483G>A;1281A>G;1794C>T n/a
8 ccsbBroad304_14747 pLX_304 0% 99.8% 100% V5 483G>A;1281A>G;1794C>T n/a
9 TRCN0000473407 TGCATTCACACTTTGGTCATCTTG pLX_317 19.4% 99.8% 100% V5 483G>A;1281A>G;1794C>T n/a
Download CSV