Transcript: Human NM_001323070.1

Homo sapiens phosphofructokinase, platelet (PFKP), transcript variant 6, mRNA.

Source:
NCBI, updated 2019-09-25
Taxon:
Homo sapiens (human)
Gene:
PFKP (5214)
Length:
2314
CDS:
535..2088

Additional Resources:

NCBI RefSeq record:
NM_001323070.1
NBCI Gene record:
PFKP (5214)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

Clone ID Target Seq Vector PAM Seq Cut Position Cut % of CDS Length Exon On Target Score[?] Other Matching Genes Orig. Target Gene[?] Notes Addgene[?]
1 BRDN0001145208 GATGTGTGTCAAACTCTCGG pXPR_003 AGG 121 8% 2 0.3675 PFKP PFKP 77627
2 BRDN0001147171 GCCGGATGATCAGATCCCAA pXPR_003 AGG 571 37% 7 0.3059 PFKP PFKP 77628
Download CSV

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001323070.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000195199 CAGCACTTTATGCACGTATTA pLKO.1 2159 3UTR 100% 13.200 18.480 N PFKP n/a
2 TRCN0000037777 CTGAACACCTACAAGCGACTT pLKO.1 1057 CDS 100% 4.050 5.670 N PFKP n/a
3 TRCN0000289009 CTGAACACCTACAAGCGACTT pLKO_005 1057 CDS 100% 4.050 5.670 N PFKP n/a
4 TRCN0000037775 GCTGAAGAAGCAAACGGATTT pLKO.1 1935 CDS 100% 10.800 7.560 N PFKP n/a
5 TRCN0000289060 GCTGAAGAAGCAAACGGATTT pLKO_005 1935 CDS 100% 10.800 7.560 N PFKP n/a
6 TRCN0000199302 CCACCGATGATTCCATTTGTG pLKO.1 1868 CDS 100% 4.950 3.465 N PFKP n/a
7 TRCN0000199329 CGAGAGGAGATTTCAAGATGC pLKO.1 1002 CDS 100% 4.050 2.835 N PFKP n/a
8 TRCN0000310258 CGAGAGGAGATTTCAAGATGC pLKO_005 1002 CDS 100% 4.050 2.835 N PFKP n/a
9 TRCN0000037774 CGTGTTCATCATCGAGACCAT pLKO.1 1461 CDS 100% 2.640 1.848 N PFKP n/a
10 TRCN0000037776 CTCGCCATCTATGATGGCTTT pLKO.1 1216 CDS 100% 0.405 0.284 N PFKP n/a
11 TRCN0000289061 CTCGCCATCTATGATGGCTTT pLKO_005 1216 CDS 100% 0.405 0.284 N PFKP n/a
12 TRCN0000199162 CCGGAGCTGATGCCGCATACA pLKO.1 1526 CDS 100% 0.000 0.000 N PFKP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001323070.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06717 pDONR223 100% 65.9% 65.9% None 0_1ins648;633A>G;882_883ins153 n/a
2 ccsbBroad304_06717 pLX_304 0% 65.9% 65.9% V5 0_1ins648;633A>G;882_883ins153 n/a
3 TRCN0000467766 TGCTGACACAGTGGCGCTGTTTGC pLX_317 19.2% 65.9% 65.9% V5 0_1ins648;633A>G;882_883ins153 n/a
4 TRCN0000488232 TGCTCTAAATTATAAATGATCATC pLX_317 13% 65.9% 65.9% V5 (not translated due to prior stop codon) 0_1ins648;633A>G;882_883ins153 n/a
5 ccsbBroadEn_15527 pDONR223 0% 65.8% 65.9% None (many diffs) n/a
6 ccsbBroad304_15527 pLX_304 0% 65.8% 65.9% V5 (many diffs) n/a
7 ccsbBroadEn_14747 pDONR223 0% 65.8% 65.9% None (many diffs) n/a
8 ccsbBroad304_14747 pLX_304 0% 65.8% 65.9% V5 (many diffs) n/a
9 TRCN0000473407 TGCATTCACACTTTGGTCATCTTG pLX_317 19.4% 65.8% 65.9% V5 (many diffs) n/a
Download CSV