Construct: ORF TRCN0000473420
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF005017.1_s317c1
- Derived from:
- ccsbBroadEn_12390
- DNA Barcode:
- AATTGGCTGACAGCTAAGCCGTGT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ZNF317 (57693)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473420
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 57693 | ZNF317 | zinc finger protein 317 | NM_001190791.2 | 73% | 73% | 1_456del |
| 2 | human | 57693 | ZNF317 | zinc finger protein 317 | NM_020933.5 | 69% | 69% | 1_552del |
| 3 | human | 57693 | ZNF317 | zinc finger protein 317 | XM_024451626.1 | 69% | 69% | 1_552del |
| 4 | human | 57693 | ZNF317 | zinc finger protein 317 | XR_430146.4 | 31% | 1_842del;2076_3970del | |
| 5 | human | 57693 | ZNF317 | zinc finger protein 317 | NR_102435.2 | 29.3% | 1_986del;2220_4202del | |
| 6 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_017313370.1 | 74.1% | 82.6% | (many diffs) |
| 7 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_017313371.1 | 74.1% | 82.6% | (many diffs) |
| 8 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_017313372.1 | 74.1% | 82.6% | (many diffs) |
| 9 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_017313373.1 | 74.1% | 82.6% | (many diffs) |
| 10 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_006510288.3 | 55.4% | 61% | (many diffs) |
| 11 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_006510289.3 | 55.4% | 61% | (many diffs) |
| 12 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_011242518.2 | 55.4% | 61% | (many diffs) |
| 13 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_017313367.1 | 55.4% | 61% | (many diffs) |
| 14 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_017313368.1 | 55.4% | 61% | (many diffs) |
| 15 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_017313369.1 | 55.4% | 61% | (many diffs) |
| 16 | mouse | 244713 | Zfp317 | zinc finger protein 317 | NM_172918.4 | 54.7% | 60.2% | (many diffs) |
| 17 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_006510274.3 | 54.7% | 60.2% | (many diffs) |
| 18 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_006510277.3 | 54.7% | 60.2% | (many diffs) |
| 19 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_006510280.3 | 54.7% | 60.2% | (many diffs) |
| 20 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_006510282.3 | 54.7% | 60.2% | (many diffs) |
| 21 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_006510283.3 | 54.7% | 60.2% | (many diffs) |
| 22 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_006510284.3 | 54.7% | 60.2% | (many diffs) |
| 23 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_006510285.3 | 54.7% | 60.2% | (many diffs) |
| 24 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_011242514.2 | 54.7% | 60.2% | (many diffs) |
| 25 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_011242515.2 | 54.7% | 60.2% | (many diffs) |
| 26 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_011242517.2 | 54.7% | 60.2% | (many diffs) |
| 27 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_017313365.1 | 54.7% | 60.2% | (many diffs) |
| 28 | mouse | 244713 | Zfp317 | zinc finger protein 317 | XM_017313366.1 | 54.7% | 60.2% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1299
- ORF length:
- 1233
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg aaggcacgct ggcaagaggc cctatcaccg ccgcgactat ggggtagcgt 121 tcaagggcag gccgcacctc actcagcaca tgagcatgta cgacgggaga aaaatgcatg 181 aatgtcatca gtgccaaaaa gccttcacca cgagcgcgtc cctcacacgg cacaggagaa 241 tccacaccgg ggagaagcct tacgagtgca gcgactgcgg gaaagccttc aacgaccctt 301 cagcccttag gagccacgca agaactcacc tcaaagagaa gccctttgac tgcagtcagt 361 gtggaaatgc attccggacc ctctcggccc tgaaaatcca catgcgagtt cacactggcg 421 agaggcctta caagtgtgat cagtgcggga aggcttacgg ccggagctgc cacctcatcg 481 cacacaagag aacgcacacc ggagagaggc cctacgagtg tcacgactgt gggaaagctt 541 tccagcaccc ctcccacctc aaagagcacg tgaggaatca cacgggggag aagccctacg 601 cgtgcacgca gtgcggcaaa gccttccgct ggaagtccaa ctttaatttg cacaagaaga 661 accacatggt ggagaagacc tacgaatgta aagaatgcgg gaaatccttt ggcgatctcg 721 tgtcccggag gaaacacatg aggattcaca tcgtcaagaa acccgtggaa tgtcggcagt 781 gcgggaagac cttccgaaac cagtccatcc ttaagactca catgaactct cacactggag 841 agaaaccata cgggtgcgat ctctgcggga aagctttcag cgcgagttca aacctcaccg 901 cacacaggaa gatacacacg caagagagac gctacgaatg cgccgcctgc gggaaagtct 961 tcggtgacta tttatcccgg cggaggcaca tgagcgttca ccttGTAAAG AAACGAGTTG 1021 AGTGTAGGCA GTGTGGCAAG GCCTTCAGGA ACCAGTCAAC GCTGAAGACG CACATGCGAA 1081 GCCACACGGG GGAGAAACCG TACGAATGCG ATCACTGTGG GAAGGCCTTC AGCATAGGCT 1141 CCAACCTGAA TGTGCACAGG CGGATCCACA CCGGGGAGAA GCCCTACGAA TGCCTTGTCT 1201 GCGGGAAAGC CTTCAGCGAC CACTCATCCC TCAGGAGCCA CGTGAAAACT CACCGGGGAG 1261 AGAAGCTCTT TGTGTCATCC GTGTGGAAAA GGCTCCAGTG CCCAACTTTC TTGTACAAAG 1321 TGGTTGATAT CGGTAAGCCT ATCCCTAACC CTCTCCTCGG TCTCGATTCT ACGTAGTAAT 1381 GAACTAGTCC GTAACTTGAA AGTATTTCGA TTTCTTGGCT TTATATATCT TGTGGAAAGG 1441 ACGAAATTGG CTGACAGCTA AGCCGTGTAC GCGTTAAGTC gacaatcaac ctctggatta 1501 caaaatttgt gaaagatt