Transcript: Mouse XM_017313365.1

PREDICTED: Mus musculus zinc finger protein 317 (Zfp317), transcript variant X3, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Zfp317 (244713)
Length:
8446
CDS:
4928..6751

Additional Resources:

NCBI RefSeq record:
XM_017313365.1
NBCI Gene record:
Zfp317 (244713)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_017313365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434197 GACTGTAGTCAGTGTAGTAAT pLKO_005 5765 CDS 100% 13.200 9.240 N Zfp317 n/a
2 TRCN0000421638 GCAAACTGGCCAGCTCTTTAT pLKO_005 7040 3UTR 100% 13.200 9.240 N Zfp317 n/a
3 TRCN0000416768 TCTAAAGTCAAATGGTCTATT pLKO_005 5336 CDS 100% 13.200 9.240 N Zfp317 n/a
4 TRCN0000081900 CCTATCAAGAAGGAAACACAT pLKO.1 6136 CDS 100% 4.950 3.465 N Zfp317 n/a
5 TRCN0000081898 CCTGAGTTGTTATGCAGCAAT pLKO.1 6834 3UTR 100% 4.950 3.465 N Zfp317 n/a
6 TRCN0000081902 GCAGATAACCAGGAATCAGAA pLKO.1 4979 CDS 100% 4.950 3.465 N Zfp317 n/a
7 TRCN0000081899 GCTAGATTCTTCCCAGAGAAA pLKO.1 5155 CDS 100% 4.950 3.465 N Zfp317 n/a
8 TRCN0000081901 CAATCTAAGTTCACTGGGTTA pLKO.1 5209 CDS 100% 4.050 2.835 N Zfp317 n/a
9 TRCN0000162177 CAAATGTGATGAGTGTGGCAA pLKO.1 5848 CDS 100% 2.640 1.584 N ZNF28 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017313365.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12390 pDONR223 100% 54.7% 60.2% None (many diffs) n/a
2 ccsbBroad304_12390 pLX_304 0% 54.7% 60.2% V5 (many diffs) n/a
3 TRCN0000473420 AATTGGCTGACAGCTAAGCCGTGT pLX_317 24.3% 54.7% 60.2% V5 (many diffs) n/a
Download CSV