Transcript: Human NM_001190791.2

Homo sapiens zinc finger protein 317 (ZNF317), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
ZNF317 (57693)
Length:
3960
CDS:
289..1980

Additional Resources:

NCBI RefSeq record:
NM_001190791.2
NBCI Gene record:
ZNF317 (57693)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001190791.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000108166 CCGCTGGAAGTCCAACTTTAA pLKO.1 1305 CDS 100% 13.200 18.480 N ZNF317 n/a
2 TRCN0000236094 CACTTCTTATGGAAGATATTT pLKO_005 608 CDS 100% 15.000 12.000 N ZNF317 n/a
3 TRCN0000236097 GAAAGTCTTCGGTGACTATTT pLKO_005 1632 CDS 100% 13.200 10.560 N ZNF317 n/a
4 TRCN0000108169 GTCACTTCTTATGGAAGATAT pLKO.1 606 CDS 100% 13.200 10.560 N ZNF317 n/a
5 TRCN0000108168 CGCTCACTTGTTCGAAGTCTT pLKO.1 696 CDS 100% 4.950 3.960 N ZNF317 n/a
6 TRCN0000236098 CTATGTGACATGAGGATATTT pLKO_005 3355 3UTR 100% 15.000 10.500 N ZNF317 n/a
7 TRCN0000108165 GCCTCCATCAAGTGGTAATAT pLKO.1 3433 3UTR 100% 15.000 10.500 N ZNF317 n/a
8 TRCN0000236096 TCCGCTGGAAGTCCAACTTTA pLKO_005 1304 CDS 100% 13.200 9.240 N ZNF317 n/a
9 TRCN0000236095 ACGCAAGAACTCACCTCAAAG pLKO_005 995 CDS 100% 10.800 7.560 N ZNF317 n/a
10 TRCN0000108167 GCTCACTTGTTCGAAGTCTTT pLKO.1 697 CDS 100% 4.950 3.465 N ZNF317 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001190791.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03842 pDONR223 100% 94.6% 94.6% None 288_289ins96 n/a
2 ccsbBroad304_03842 pLX_304 0% 94.6% 94.6% V5 288_289ins96 n/a
3 TRCN0000465801 AGTAAAAAACAGCTTATAAACCTC pLX_317 20% 94.6% 94.6% V5 288_289ins96 n/a
4 ccsbBroadEn_12390 pDONR223 100% 73% 73% None 1_456del n/a
5 ccsbBroad304_12390 pLX_304 0% 73% 73% V5 1_456del n/a
6 TRCN0000473420 AATTGGCTGACAGCTAAGCCGTGT pLX_317 24.3% 73% 73% V5 1_456del n/a
Download CSV