Construct: ORF TRCN0000473588
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006151.1_s317c1
- Derived from:
- ccsbBroadEn_04879
- DNA Barcode:
- GACTTTATTTAGCACTATAACACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- SYNPR (132204)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473588
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 132204 | SYNPR | synaptoporin | NM_144642.5 | 100% | 100% | |
2 | human | 132204 | SYNPR | synaptoporin | NM_001130003.2 | 91.9% | 90.1% | (many diffs) |
3 | human | 132204 | SYNPR | synaptoporin | XM_017005731.1 | 87.2% | 85.3% | (many diffs) |
4 | human | 132204 | SYNPR | synaptoporin | XM_017005732.2 | 67% | 57% | (many diffs) |
5 | mouse | 72003 | Synpr | synaptoporin | NM_001163032.1 | 89.8% | 95.8% | (many diffs) |
6 | mouse | 72003 | Synpr | synaptoporin | NM_028052.4 | 81% | 86.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 861
- ORF length:
- 795
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtg tatggtgata tttgctccgc tttttgcaat ctttgcattt gcaacatgcg 121 gtggctattc tggaggcctg cggctgagtg tggactgcgt caacaagaca gaaagtaacc 181 tcagcatcga catagcgttt gcctacccat tcaggttgca ccaggtgacg tttgaggtgc 241 ccacctgcga gggaaaggaa cggcagaagc tggcattgat tggtgactcc tcgtcttcag 301 cagagttctt cgtcactgtt gctgtcttcg ccttcctcta ctctttggct gccactgtcg 361 tttacatttt cttccagaac aaataccggg aaaacaaccg gggcccactc attgacttca 421 ttgtcactgt agtcttttcg ttcttgtggt tggtgggttc atcagcttgg gcaaaaggac 481 tgtctgacgt caaagttgca acggatccca aggaagtatt gctactaatg tcagcttgca 541 aacagccaTC CAACAAATGC ATGGCTATCC ACAGCCCTGT TATGTCAAGC TTAAACACTT 601 CTGTGGTCTT TGGATTCTTG AACTTTATTC TCTGGGCTGG AAACATATGG TTTGTTTTCA 661 AGGAGACCGG CTGGCATTCT TCGGGACAGA GATATCTTTC AGATCCAATG GAGAAGCACT 721 CCAGCAGCTA TAATCAAGGT GGTTACAACC AAGACAGCTA TGGATCAAGC AGTGGGTACA 781 GTCAGCAGGC GAGTTTGGGG CCAACCTCAG ATGAGTTTGG CCAACAGCCT ACTGGCCCCA 841 CTTCCTTTAC CAATCAGATT TACCCAACTT TCTTGTACAA AGTGGTTGAT ATCGGTAAGC 901 CTATCCCTAA CCCTCTCCTC GGTCTCGATT CTACGTAGTA ATGAACTAGT CCGTAACTTG 961 AAAGTATTTC GATTTCTTGG CTTTATATAT CTTGTGGAAA GGACGAGACT TTATTTAGCA 1021 CTATAACACA ACGCGTTAAG TCgacaatca acctctggat tacaaaattt gtgaaagatt