Transcript: Mouse NM_001163032.1

Mus musculus synaptoporin (Synpr), transcript variant 2, mRNA.

Source:
NCBI, updated 2017-05-27
Taxon:
Mus musculus (mouse)
Gene:
Synpr (72003)
Length:
2657
CDS:
372..1169

Additional Resources:

NCBI RefSeq record:
NM_001163032.1
NBCI Gene record:
Synpr (72003)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse NM_001163032.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000093207 ACATAGCGTTTGCGTACCCAT pLKO.1 496 CDS 100% 2.640 3.696 N Synpr n/a
2 TRCN0000093204 GCTGTATTTCTGGAGACATTT pLKO.1 1726 3UTR 100% 13.200 9.240 N Synpr n/a
3 TRCN0000093206 CCTCTGGACAGAGATACCTTT pLKO.1 985 CDS 100% 4.950 3.465 N Synpr n/a
4 TRCN0000093205 CTCAGCATTGACATAGCGTTT pLKO.1 486 CDS 100% 4.050 2.835 N Synpr n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001163032.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04879 pDONR223 100% 89.8% 95.8% None (many diffs) n/a
2 ccsbBroad304_04879 pLX_304 0% 89.8% 95.8% V5 (many diffs) n/a
3 TRCN0000473588 GACTTTATTTAGCACTATAACACA pLX_317 39.6% 89.8% 95.8% V5 (many diffs) n/a
Download CSV