Construct: ORF TRCN0000473591
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF004551.1_s317c1
- Derived from:
- ccsbBroadEn_03047
- DNA Barcode:
- AGGATATTAACCGCGTTTGTCCAC
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- BZW2 (28969)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473591
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 28969 | BZW2 | basic leucine zipper and W2... | NM_001159767.1 | 100% | 100% | |
| 2 | human | 28969 | BZW2 | basic leucine zipper and W2... | NM_001362717.2 | 100% | 100% | |
| 3 | human | 28969 | BZW2 | basic leucine zipper and W2... | NM_014038.3 | 100% | 100% | |
| 4 | human | 28969 | BZW2 | basic leucine zipper and W2... | XM_006715707.1 | 100% | 100% | |
| 5 | human | 28969 | BZW2 | basic leucine zipper and W2... | XM_006715708.1 | 100% | 100% | |
| 6 | human | 28969 | BZW2 | basic leucine zipper and W2... | NM_001362718.2 | 53.6% | 53.6% | 0_1ins582 |
| 7 | human | 28969 | BZW2 | basic leucine zipper and W2... | NM_001362719.2 | 53.6% | 53.6% | 0_1ins582 |
| 8 | mouse | 66912 | Bzw2 | basic leucine zipper and W2... | NM_025840.3 | 91.7% | 99% | (many diffs) |
| 9 | mouse | 66912 | Bzw2 | basic leucine zipper and W2... | XM_006515166.2 | 83.4% | 85.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1323
- ORF length:
- 1257
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgaa taagcatcag aagccagtgc taacaggcca gcggttcaaa actcggaaaa 121 gggatgaaaa agagaaattc gaacccacag tcttcaggga tacacttgtc caggggctta 181 atgaggctgg tgatgacctt gaagctgtag ccaaatttct ggactctaca ggctcaagat 241 tagattatcg tcgctatgca gacacactct tcgatatcct ggtggctggc agtatgcttg 301 cccctggagg aacgcgcata gatgatggtg acaagaccaa gatgaccaac cactgtgtgt 361 tttcagcaaa tgaagatcat gaaaccatcc gaaactatgc tcaggtcttc aataaactca 421 tcaggagata taagtatttg gagaaggcat ttgaagatga aatgaaaaag cttctcctct 481 tccttaaagc cttttccgaa acagagcaga caaagttggc gatgctgtcg gggattctgc 541 tgggcaatgg caccctgccc gccaccatcc tcaccagtct cttcaccgac agcttagtca 601 aagaaggcat tgcggcctca tttgctgtca agcttttcaa agcatggatg gcagaaaaag 661 atgccaactc tgttacctcg tctttgagaa aagccaactt agacaagagg ctgcttgaac 721 tctttccagt taacagacag agtgtggatc attttgctaa atacttcact gacgcaggtc 781 ttaaggagct ttccgacttc ctccgagtcc agcagtccct gggcaccagg aaggaactgc 841 agaaggagct ccaggagcgt ctttctcagg aatgcccgat caaggaggtg gtgctttatg 901 tcaaaGAAGA AATGAAGAGG AATGATCTTC CAGAAACAGC AGTGATTGGT CTTCTGTGGA 961 CATGTATAAT GAACGCTGTT GAGTGGAACA AGAAGGAAGA ACTTGTTGCA GAGCAGGCTC 1021 TGAAGCACCT GAAGCAATAT GCTCCCCTGC TGGCCGTGTT CAGCTCCCAA GGCCAGTCAG 1081 AGCTGATCCT CCTCCAGAAG GTTCAGGAAT ACTGCTACGA CAACATCCAT TTCATGAAAG 1141 CCTTTCAGAA GATTGTGGTT CTCTTTTATA AAGCTGATGT TCTGAGCGAA GAAGCAATAC 1201 TGAAATGGTA TAAGGAAGCA CATGTTGCTA AAGGCAAAAG TGTTTTTCTT GACCAGATGA 1261 AGAAATTTGT TGAGTGGTTA CAAAATGCAG AAGAAGAATC CGAATCGGAA GGTGAGGAAA 1321 ATTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1381 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1441 GGCTTTATAT ATCTTGTGGA AAGGACGAAG GATATTAACC GCGTTTGTCC ACACGCGTTA 1501 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt