Construct: ORF TRCN0000473600
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF012566.1_s317c1
- Derived from:
- ccsbBroadEn_13367
- DNA Barcode:
- CGGGAGACTAGCCACCCGCCTACA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- METTL15 (196074)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473600
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 196074 | METTL15 | methyltransferase like 15 | NM_001297775.2 | 75.7% | 75.6% | 1_201del;427C>T;571C>T |
| 2 | human | 196074 | METTL15 | methyltransferase like 15 | XM_017017301.2 | 63.8% | 46.4% | (many diffs) |
| 3 | human | 196074 | METTL15 | methyltransferase like 15 | NM_152636.3 | 63.8% | 51.5% | (many diffs) |
| 4 | human | 196074 | METTL15 | methyltransferase like 15 | XM_011519940.3 | 59.6% | 59.4% | (many diffs) |
| 5 | human | 196074 | METTL15 | methyltransferase like 15 | XM_011519935.3 | 57.6% | 37% | (many diffs) |
| 6 | human | 196074 | METTL15 | methyltransferase like 15 | XM_024448380.1 | 57.6% | 37% | (many diffs) |
| 7 | human | 196074 | METTL15 | methyltransferase like 15 | XM_024448381.1 | 57.6% | 37% | (many diffs) |
| 8 | human | 196074 | METTL15 | methyltransferase like 15 | XM_017017300.2 | 54.2% | 35% | (many diffs) |
| 9 | human | 196074 | METTL15 | methyltransferase like 15 | XM_011519941.2 | 53% | 53% | 1_201del;407_408ins192 |
| 10 | human | 196074 | METTL15 | methyltransferase like 15 | NM_001113528.2 | 51.9% | 35.9% | (many diffs) |
| 11 | human | 196074 | METTL15 | methyltransferase like 15 | XM_017017297.2 | 51.9% | 35.9% | (many diffs) |
| 12 | human | 196074 | METTL15 | methyltransferase like 15 | XM_017017303.2 | 40.3% | 21.5% | (many diffs) |
| 13 | human | 196074 | METTL15 | methyltransferase like 15 | XM_024448382.1 | 40.3% | 21.5% | (many diffs) |
| 14 | human | 196074 | METTL15 | methyltransferase like 15 | XR_930849.2 | 32.4% | (many diffs) | |
| 15 | human | 196074 | METTL15 | methyltransferase like 15 | XR_001747787.1 | 15.6% | (many diffs) | |
| 16 | mouse | 76894 | Mettl15 | methyltransferase like 15 | NM_029790.3 | 44.6% | 30.9% | (many diffs) |
| 17 | mouse | 76894 | Mettl15 | methyltransferase like 15 | XM_006500378.1 | 44.6% | 30.9% | (many diffs) |
| 18 | mouse | 76894 | Mettl15 | methyltransferase like 15 | XM_006500379.3 | 44.6% | 30.9% | (many diffs) |
| 19 | mouse | 76894 | Mettl15 | methyltransferase like 15 | XM_011239840.2 | 32% | 16.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 702
- ORF length:
- 636
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggc taaattacat attccagtaa tggtggatga agttgttcat tgtttgtcac 121 cacaaaaagg acagattttt ctagatatga catttggttc gggagggcac acaaaagcca 181 ttctgcagaa ggagtcagat attgttctct atgccttgga cagagaccca acagcttatg 241 cattagctga acatctttca gagttgtatc ctaaacaaat ccgagctatg ttgggccagt 301 tcagccaggc agaagcctta ttaatgaaag ctggagtgca gccaggaact tttgatGGAG 361 TTCTTATGGA TCTTGGGTGT TCCTCCATGC AACTTGATAC TCCTGAAAGA GGTTTTTCCC 421 TTCGGAAAGA TGGCTCTTTG GACATGAGAA TGGATGGTGG CAGATCAACA GGCACTTGCA 481 TCTATCCTAA GAACATACGG GGAGGAGAAG CATGCCAAGA AAATCGCTTC AGCAATTGTT 541 CAGGCACGCA GCATCTACCC CATCACCAGA ACCCAGCAGC TTGCCAGCAT CGTTGCAGGA 601 GCATTTCCTC CCTCTGCTAT TTATACACGG AAAGACTTAC TACAGCGATC TACCCATATT 661 GCCACCAAGA CTTTCCAGGC TCTTCGCATA TTTGTGAACA ATGCCCAACT TTCTTGTACA 721 AAGTGGTTGA TATCGGTAAG CCTATCCCTA ACCCTCTCCT CGGTCTCGAT TCTACGTAGT 781 AATGAACTAG TCCGTAACTT GAAAGTATTT CGATTTCTTG GCTTTATATA TCTTGTGGAA 841 AGGACGACGG GAGACTAGCC ACCCGCCTAC AACGCGTTAA GTCgacaatc aacctctgga 901 ttacaaaatt tgtgaaagat t