Transcript: Human NM_001297775.2

Homo sapiens methyltransferase like 15 (METTL15), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
METTL15 (196074)
Length:
4164
CDS:
319..1158

Additional Resources:

NCBI RefSeq record:
NM_001297775.2
NBCI Gene record:
METTL15 (196074)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001297775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414828 AGCTTAGAGCAGCTATCAAAT pLKO_005 1473 3UTR 100% 13.200 18.480 N METTL15 n/a
2 TRCN0000428358 CCGGGAGCAAACAGATCAAAC pLKO_005 453 CDS 100% 10.800 8.640 N METTL15 n/a
3 TRCN0000430401 AGCCAGGCAGAAGCCTTATTA pLKO_005 757 CDS 100% 15.000 10.500 N METTL15 n/a
4 TRCN0000183132 CACTTGCATCTATCCTAAGAA pLKO.1 927 CDS 100% 5.625 3.938 N METTL15 n/a
5 TRCN0000148099 GCTTTCTCAAATGTAGGCTTT pLKO.1 1963 3UTR 100% 4.050 2.835 N METTL15 n/a
6 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3348 3UTR 100% 4.950 2.475 Y ERAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001297775.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13367 pDONR223 100% 75.7% 75.6% None 1_201del;427C>T;571C>T n/a
2 ccsbBroad304_13367 pLX_304 0% 75.7% 75.6% V5 1_201del;427C>T;571C>T n/a
3 TRCN0000473600 CGGGAGACTAGCCACCCGCCTACA pLX_317 54.2% 75.7% 75.6% V5 1_201del;427C>T;571C>T n/a
Download CSV