Transcript: Human NM_152636.3

Homo sapiens methyltransferase like 15 (METTL15), transcript variant 2, mRNA.

Source:
NCBI, updated 2019-05-31
Taxon:
Homo sapiens (human)
Gene:
METTL15 (196074)
Length:
4279
CDS:
319..1140

Additional Resources:

NCBI RefSeq record:
NM_152636.3
NBCI Gene record:
METTL15 (196074)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_152636.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414828 AGCTTAGAGCAGCTATCAAAT pLKO_005 1588 3UTR 100% 13.200 18.480 N METTL15 n/a
2 TRCN0000428358 CCGGGAGCAAACAGATCAAAC pLKO_005 453 CDS 100% 10.800 8.640 N METTL15 n/a
3 TRCN0000430401 AGCCAGGCAGAAGCCTTATTA pLKO_005 757 CDS 100% 15.000 10.500 N METTL15 n/a
4 TRCN0000147440 GCTGATGTTGTGAATGCTTTA pLKO.1 940 CDS 100% 10.800 7.560 N METTL15 n/a
5 TRCN0000183132 CACTTGCATCTATCCTAAGAA pLKO.1 971 CDS 100% 5.625 3.938 N METTL15 n/a
6 TRCN0000179243 GCTTTAGATCAACAGGCACTT pLKO.1 955 CDS 100% 4.050 2.835 N METTL15 n/a
7 TRCN0000148099 GCTTTCTCAAATGTAGGCTTT pLKO.1 2078 3UTR 100% 4.050 2.835 N METTL15 n/a
8 TRCN0000147145 CTCTGAAACATATTTCCCAGT pLKO.1 1101 CDS 100% 2.160 1.512 N METTL15 n/a
9 TRCN0000222574 CGCCTGTAATCCCAGCACTTT pLKO.1 3463 3UTR 100% 4.950 2.475 Y ERAP2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_152636.3, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13367 pDONR223 100% 63.8% 51.5% None (many diffs) n/a
2 ccsbBroad304_13367 pLX_304 0% 63.8% 51.5% V5 (many diffs) n/a
3 TRCN0000473600 CGGGAGACTAGCCACCCGCCTACA pLX_317 54.2% 63.8% 51.5% V5 (many diffs) n/a
Download CSV