Construct: ORF TRCN0000473603
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF003625.1_s317c1
- Derived from:
- ccsbBroadEn_15640
- DNA Barcode:
- CAATTGCTTAGAGTCCTTTGCACT
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- PLA2G4C (8605)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473603
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
---|---|---|---|---|---|---|---|---|
1 | human | 8605 | PLA2G4C | phospholipase A2 group IVC | XM_017027414.2 | 69.2% | 65.5% | (many diffs) |
2 | human | 8605 | PLA2G4C | phospholipase A2 group IVC | XM_011527433.3 | 50.9% | 48.4% | (many diffs) |
3 | human | 8605 | PLA2G4C | phospholipase A2 group IVC | XM_011527432.3 | 43.9% | 41.9% | (many diffs) |
4 | human | 8605 | PLA2G4C | phospholipase A2 group IVC | XM_017027411.2 | 38.4% | 36.7% | (many diffs) |
5 | human | 8605 | PLA2G4C | phospholipase A2 group IVC | XM_011527431.3 | 37.4% | 35.7% | (many diffs) |
6 | human | 8605 | PLA2G4C | phospholipase A2 group IVC | NM_001159323.1 | 37.1% | 35.5% | (many diffs) |
7 | human | 8605 | PLA2G4C | phospholipase A2 group IVC | NM_003706.3 | 36.2% | 34.6% | (many diffs) |
8 | human | 8605 | PLA2G4C | phospholipase A2 group IVC | NM_001159322.1 | 34.6% | 31.6% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 663
- ORF length:
- 597
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg aagctctgaa gtttccataa ttcctgggct ccagaaagaa gaaaaggcgg 121 ccgtggagag acgaagactt catgtgctga aagctctgaa gaagctaagg attgaggctg 181 atgaggcccc agttgttgct gtgctgggct caggcggagg actgcgggct cacattgcct 241 gccttggggt cctgagtgag atgaaagaac agggcctgtt ggatgccgtc acgtacctcg 301 caggggtctc tggatccact tgggcaatat cttctctcta caccaatgat ggtgacatgg 361 aagctctcga ggctgaccTG AAACATCGAT TTACCCGACA GGAGTGGGAC TTGGCTAAGA 421 GCCTACAGAA AACCATCCAA GCAGCGAGGT CTGAGAATTA CTCTCTGACC GACTTCTGGG 481 CCTACATGGT TATCTCTAAG CAAACCAGAG AACTGCCGGA GTCTCATTTG TCCAATATGA 541 AGAAGCCCGT GGAAGAAGGG ACACTACCCT ACCCAATATT TGCAGCCATT GACAATGACC 601 TGCAACCTTC CTGGCAGGAG GCAAGAGCAC CAGGTAAGCA AACATTTAGA GGGAGGGAGA 661 GGTACCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 721 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 781 GGCTTTATAT ATCTTGTGGA AAGGACGACA ATTGCTTAGA GTCCTTTGCA CTACGCGTTA 841 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt