Transcript: Human NM_001159323.1

Homo sapiens phospholipase A2 group IVC (PLA2G4C), transcript variant 3, mRNA.

Source:
NCBI, updated 2019-08-04
Taxon:
Homo sapiens (human)
Gene:
PLA2G4C (8605)
Length:
2567
CDS:
399..1982

Additional Resources:

NCBI RefSeq record:
NM_001159323.1
NBCI Gene record:
PLA2G4C (8605)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human NM_001159323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000414397 AGTAAGAACTTGGGCTTAAAT pLKO_005 2463 3UTR 100% 15.000 21.000 N PLA2G4C n/a
2 TRCN0000055552 GCTGACCTGAAACATCGATTT pLKO.1 705 CDS 100% 10.800 15.120 N PLA2G4C n/a
3 TRCN0000055549 CCGGAGTCTCATTTGTCCAAT pLKO.1 849 CDS 100% 4.950 3.960 N PLA2G4C n/a
4 TRCN0000426218 TGGACCAGTGGTGATGCATTT pLKO_005 1778 CDS 100% 10.800 7.560 N PLA2G4C n/a
5 TRCN0000055550 CGAAGACTTCATGTGCTGAAA pLKO.1 465 CDS 100% 4.950 3.465 N PLA2G4C n/a
6 TRCN0000055551 CCCTGAAAGGTTTATGGAGAA pLKO.1 1180 CDS 100% 4.050 2.835 N PLA2G4C n/a
7 TRCN0000055548 GCCAAGAAGAATGTCAGGGAA pLKO.1 1917 CDS 100% 2.640 1.848 N PLA2G4C n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript NM_001159323.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15640 pDONR223 0% 37.1% 35.5% None (many diffs) n/a
2 ccsbBroad304_15640 pLX_304 0% 37.1% 35.5% V5 (many diffs) n/a
3 TRCN0000473603 CAATTGCTTAGAGTCCTTTGCACT pLX_317 47.8% 37.1% 35.5% V5 (many diffs) n/a
Download CSV