Transcript: Human XM_017027414.2

PREDICTED: Homo sapiens phospholipase A2 group IVC (PLA2G4C), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLA2G4C (8605)
Length:
1932
CDS:
930..1778

Additional Resources:

NCBI RefSeq record:
XM_017027414.2
NBCI Gene record:
PLA2G4C (8605)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017027414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000055552 GCTGACCTGAAACATCGATTT pLKO.1 1236 CDS 100% 10.800 15.120 N PLA2G4C n/a
2 TRCN0000055549 CCGGAGTCTCATTTGTCCAAT pLKO.1 1380 CDS 100% 4.950 3.960 N PLA2G4C n/a
3 TRCN0000055550 CGAAGACTTCATGTGCTGAAA pLKO.1 996 CDS 100% 4.950 3.465 N PLA2G4C n/a
4 TRCN0000055551 CCCTGAAAGGTTTATGGAGAA pLKO.1 1711 CDS 100% 4.050 2.835 N PLA2G4C n/a
5 TRCN0000072628 CCTCCCAAAGTGCTAGGATTA pLKO.1 263 5UTR 100% 10.800 5.400 Y MRPS16 n/a
6 TRCN0000140657 CCTCCCAAAGTGCTAGGATAA pLKO.1 263 5UTR 100% 10.800 5.400 Y CD3EAP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017027414.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_15640 pDONR223 0% 69.2% 65.5% None (many diffs) n/a
2 ccsbBroad304_15640 pLX_304 0% 69.2% 65.5% V5 (many diffs) n/a
3 TRCN0000473603 CAATTGCTTAGAGTCCTTTGCACT pLX_317 47.8% 69.2% 65.5% V5 (many diffs) n/a
Download CSV