Construct: ORF TRCN0000473677
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF013808.1_s317c1
- Derived from:
- ccsbBroadEn_05824
- DNA Barcode:
- GATCTGATTCTTACAGCACTATAG
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- ANXA2 (302)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473677
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- n/a
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 302 | ANXA2 | annexin A2 | NM_001002857.2 | 99.9% | 99.7% | 878T>C |
| 2 | human | 302 | ANXA2 | annexin A2 | NM_001136015.3 | 99.9% | 99.7% | 878T>C |
| 3 | human | 302 | ANXA2 | annexin A2 | NM_004039.3 | 99.9% | 99.7% | 878T>C |
| 4 | human | 302 | ANXA2 | annexin A2 | XM_017022090.1 | 99.9% | 99.7% | 878T>C |
| 5 | human | 302 | ANXA2 | annexin A2 | XM_017022091.1 | 99.9% | 99.7% | 878T>C |
| 6 | human | 302 | ANXA2 | annexin A2 | NM_001002858.3 | 94.8% | 94.6% | 1_54del;932T>C |
| 7 | human | 304 | ANXA2P2 | annexin A2 pseudogene 2 | NR_003573.1 | 76.3% | (many diffs) | |
| 8 | human | 303 | ANXA2P1 | annexin A2 pseudogene 1 | NR_001562.2 | 68.7% | (many diffs) | |
| 9 | human | 305 | ANXA2P3 | annexin A2 pseudogene 3 | NR_001446.2 | 68.3% | (many diffs) | |
| 10 | human | 302 | ANXA2 | annexin A2 | XM_017022092.1 | 65.3% | 65.1% | 0_1ins351;527T>C |
| 11 | human | 302 | ANXA2 | annexin A2 | XM_017022093.1 | 65.3% | 65.1% | 0_1ins351;527T>C |
| 12 | human | 302 | ANXA2 | annexin A2 | XM_024449908.1 | 65.3% | 65.1% | 0_1ins351;527T>C |
| 13 | mouse | 12306 | Anxa2 | annexin A2 | NM_007585.3 | 89.4% | 97.3% | (many diffs) |
| 14 | mouse | 12306 | Anxa2 | annexin A2 | XM_006510796.2 | 89.4% | 97.3% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 1083
- ORF length:
- 1017
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatgtc tactgttcac gaaatcctgt gcaagctcag cttggagggt gatcactcta 121 cacccccaag tgcatatggg tctgtcaaag cctatactaa ctttgatgct gagcgggatg 181 ctttgaacat tgaaacagcc atcaagacca aaggtgtgga tgaggtcacc attgtcaaca 241 ttttgaccaa ccgcagcaat gcacagagac aggatattgc cttcgcctac cagagaagga 301 ccaaaaagga acttgcatca gcactgaagt cagccttatc tggccacctg gagacggtga 361 ttttgggcct attgaagaca cctgctcagt atgacgcttc tgagctaaaa gcttccatga 421 aggggctggg aaccgacgag gactctctca ttgagatcat ctgctccaga accaaccagg 481 agctgcagga aattaacaga gtctacaagg aaatgtacaa gactgatctg gagaaggaca 541 ttatttcgga cacatctggt gacttccgca agctgatggt tgccctggca aagggtagaa 601 gagcagagga tGGCTCTGTC ATTGATTATG AACTGATTGA CCAAGATGCT CGGGATCTCT 661 ATGACGCTGG AGTGAAGAGG AAAGGAACTG ATGTTCCCAA GTGGATCAGC ATCATGACCG 721 AGCGGAGCGT GCCCCACCTC CAGAAAGTAT TTGATAGGTA CAAGAGTTAC AGCCCTTATG 781 ACATGTTGGA AAGCATCAGG AAAGAGGTTA AAGGAGACCT GGAAAATGCT TTCCTGAACC 841 TGGTTCAGTG CATTCAGAAC AAGCCCCTGT ATTTTGCTGA TCGGCTGTAT GACTCCATGA 901 AGGGCAAGGG GACGCGAGAT AAGGTCCTGA TCAGAATCAT GGCCTCCCGC AGTGAAGTGG 961 ACATGTTGAA AATTAGGTCT GAATTCAAGA GAAAGTACGG CAAGTCCCTG TACTATTATA 1021 TCCAGCAAGA CACTAAGGGC GACTACCAGA AAGCGCTGCT GTACCTGTGT GGTGGAGATG 1081 ACTGCCCAAC TTTCTTGTAC AAAGTGGTTG ATATCGGTAA GCCTATCCCT AACCCTCTCC 1141 TCGGTCTCGA TTCTACGTAG TAATGAACTA GTCCGTAACT TGAAAGTATT TCGATTTCTT 1201 GGCTTTATAT ATCTTGTGGA AAGGACGAGA TCTGATTCTT ACAGCACTAT AGACGCGTTA 1261 AGTCgacaat caacctctgg attacaaaat ttgtgaaaga tt