Transcript: Human XM_024449908.1

PREDICTED: Homo sapiens annexin A2 (ANXA2), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ANXA2 (302)
Length:
4873
CDS:
3904..4572

Additional Resources:

NCBI RefSeq record:
XM_024449908.1
NBCI Gene record:
ANXA2 (302)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_024449908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000296322 TGAGGGTGACGTTAGCATTAC pLKO_005 4675 3UTR 100% 10.800 6.480 N ANXA2 n/a
2 TRCN0000056147 CTGTACTATTATATCCAGCAA pLKO.1 4495 CDS 100% 2.640 1.584 N ANXA2 n/a
3 TRCN0000056144 GCAGGAAATTAACAGAGTCTA pLKO.1 3972 CDS 100% 4.950 2.475 Y ANXA2 n/a
4 TRCN0000289717 GCAGGAAATTAACAGAGTCTA pLKO_005 3972 CDS 100% 4.950 2.475 Y ANXA2 n/a
5 TRCN0000056146 CCAGAAAGTATTTGATAGGTA pLKO.1 4227 CDS 100% 3.000 1.500 Y ANXA2 n/a
6 TRCN0000130146 CAGGTTCAAGTGATTCTCCTA pLKO.1 1925 5UTR 100% 2.640 1.320 Y DICER1-AS1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_024449908.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05825 pDONR223 100% 65.4% 65.4% None 0_1ins351 n/a
2 ccsbBroad304_05825 pLX_304 0% 65.4% 65.4% V5 0_1ins351 n/a
3 TRCN0000481142 GTGTACGCTCCACGTCAGGCGAGA pLX_317 40.9% 65.4% 65.4% V5 0_1ins351 n/a
4 ccsbBroadEn_05823 pDONR223 100% 65.4% 65.4% None 0_1ins351 n/a
5 ccsbBroad304_05823 pLX_304 0% 65.4% 65.4% V5 0_1ins351 n/a
6 TRCN0000469148 TGGACGTAATTCCCTTTGCCTTGC pLX_317 42.5% 65.4% 65.4% V5 0_1ins351 n/a
7 ccsbBroadEn_05824 pDONR223 100% 65.3% 65.1% None 0_1ins351;527T>C n/a
8 ccsbBroad304_05824 pLX_304 0% 65.3% 65.1% V5 0_1ins351;527T>C n/a
9 TRCN0000473677 GATCTGATTCTTACAGCACTATAG pLX_317 46.4% 65.3% 65.1% V5 0_1ins351;527T>C n/a
10 TRCN0000491537 ATGCTAGCTATTGCAATTGCTAGA pLX_317 31.3% 62.1% 62.1% V5 (not translated due to prior stop codon) 0_1ins405 n/a
11 TRCN0000488206 GGGGAAACCTCAGCTGTGATCTAA pLX_317 29% 62.1% 62% V5 0_1ins405;666_667insG n/a
Download CSV