Transcript: Mouse XM_006510796.2

PREDICTED: Mus musculus annexin A2 (Anxa2), transcript variant X1, mRNA.

Source:
NCBI, updated 2016-06-22
Taxon:
Mus musculus (mouse)
Gene:
Anxa2 (12306)
Length:
1736
CDS:
430..1449

Additional Resources:

NCBI RefSeq record:
XM_006510796.2
NBCI Gene record:
Anxa2 (12306)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Mouse XM_006510796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Mouse Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000110697 AGTTATTGACTACGAGCTGAT pLKO.1 981 CDS 100% 4.050 5.670 N Anxa2 n/a
2 TRCN0000332119 AGTTATTGACTACGAGCTGAT pLKO_005 981 CDS 100% 4.050 5.670 N Anxa2 n/a
3 TRCN0000110696 GTATGATGCTTCGGAACTAAA pLKO.1 753 CDS 100% 13.200 10.560 N Anxa2 n/a
4 TRCN0000332047 GTATGATGCTTCGGAACTAAA pLKO_005 753 CDS 100% 13.200 10.560 N Anxa2 n/a
5 TRCN0000110699 CGAGACAAGGTCCTGATTAGA pLKO.1 1279 CDS 100% 5.625 4.500 N Anxa2 n/a
6 TRCN0000332118 CGAGACAAGGTCCTGATTAGA pLKO_005 1279 CDS 100% 5.625 4.500 N Anxa2 n/a
7 TRCN0000110695 GTTATTGACTACGAGCTGATT pLKO.1 982 CDS 100% 4.950 3.465 N Anxa2 n/a
8 TRCN0000110698 GAGCATCAAGAAAGAGGTCAA pLKO.1 1155 CDS 100% 4.050 2.430 N Anxa2 n/a
9 TRCN0000332048 GAGCATCAAGAAAGAGGTCAA pLKO_005 1155 CDS 100% 4.050 2.430 N Anxa2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_006510796.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05825 pDONR223 100% 89.4% 97.6% None (many diffs) n/a
2 ccsbBroad304_05825 pLX_304 0% 89.4% 97.6% V5 (many diffs) n/a
3 TRCN0000481142 GTGTACGCTCCACGTCAGGCGAGA pLX_317 40.9% 89.4% 97.6% V5 (many diffs) n/a
4 ccsbBroadEn_05823 pDONR223 100% 89.4% 97.3% None (many diffs) n/a
5 ccsbBroad304_05823 pLX_304 0% 89.4% 97.3% V5 (many diffs) n/a
6 TRCN0000469148 TGGACGTAATTCCCTTTGCCTTGC pLX_317 42.5% 89.4% 97.3% V5 (many diffs) n/a
7 ccsbBroadEn_05824 pDONR223 100% 89.4% 97.3% None (many diffs) n/a
8 ccsbBroad304_05824 pLX_304 0% 89.4% 97.3% V5 (many diffs) n/a
9 TRCN0000473677 GATCTGATTCTTACAGCACTATAG pLX_317 46.4% 89.4% 97.3% V5 (many diffs) n/a
10 TRCN0000491537 ATGCTAGCTATTGCAATTGCTAGA pLX_317 31.3% 85% 92.7% V5 (not translated due to prior stop codon) (many diffs) n/a
11 TRCN0000488206 GGGGAAACCTCAGCTGTGATCTAA pLX_317 29% 84.9% 92.4% V5 (many diffs) n/a
Download CSV