Construct: ORF TRCN0000473711
Construct Description:
- Construct Type:
- ORF
- Other Identifiers:
- ORF006512.1_s317c1
- Derived from:
- ccsbBroadEn_07881
- DNA Barcode:
- TAAAGTTAATAGTGATTTCTTATA
- Epitope Tag:
- V5
- Notes:
- No stop codon in insert
Originally Annotated References:
- Gene:
- NCS1 (23413)
Vector Information:
- Vector Backbone:
- pLX_317
- Pol II Cassette 1:
- SV40-PuroR
- Pol II Cassette 2:
- EF1a-TRCN0000473711
- Selection Marker:
- PuroR
- Visible Reporter:
- n/a
- Epitope Tag:
- V5
Current transcripts matched by this ORF:
| Taxon | Gene | Symbol | Description | Transcript | Nuc. Match %[?]A simple nucleotide-based global alignment percentage, calculated as follows: total nt. matches ---------------------------------- aligned length (incl. gaps) |
Prot. Match %[?]A simple amino acid-based global alignment percentage, calculated as follows: total aa. matches ---------------------------------- aligned length (incl. gaps) |
Match Diffs[?]This field may contain sequence annotations in HGVS format. For more information about HGVS annotations, please refer to the HGVS Quick Reference Guide. | |
|---|---|---|---|---|---|---|---|---|
| 1 | human | 23413 | NCS1 | neuronal calcium sensor 1 | NM_014286.4 | 99.8% | 100% | 516T>G |
| 2 | human | 23413 | NCS1 | neuronal calcium sensor 1 | NM_001128826.2 | 89.6% | 88.4% | (many diffs) |
| 3 | mouse | 14299 | Ncs1 | neuronal calcium sensor 1 | NM_019681.3 | 90.3% | 100% | (many diffs) |
| 4 | mouse | 14299 | Ncs1 | neuronal calcium sensor 1 | XR_866007.2 | 10.7% | (many diffs) | |
| 5 | mouse | 14299 | Ncs1 | neuronal calcium sensor 1 | XR_866008.2 | 10.7% | (many diffs) |
Sequence Information
Note: uppercase bases indicate empirically verified sequence.
- ORF start:
- 66
- ORF end:
- 636
- ORF length:
- 570
- Sequence:
-
1 tcttccattt caggtgtcgt gaggctagca tcgattgatc aacaagtttg tacaaaaaag 61 ttggcatggg gaaatccaac agcaagttga agcccgaagt tgtggaggag ctgaccagga 121 agacctactt taccgagaag gaggtccagc agtggtacaa aggcttcatc aaggactgcc 181 ccagtgggca gctggatgcg gcaggcttcc agaagatcta caagcaattc ttcccgttcg 241 gagaccccac caagtttgcc acatttgttt tcaacgtctt tgatgaaaac aaggacgggc 301 gaattgagtt ctccgagttc atccaggcgc tgtcggtgac ctcacgggga accctggatg 361 agaagctacg gtgggccttc aagctctacg acttggacaa tgatGGCTAC ATCACCAGGA 421 ATGAGATGCT GGACATTGTG GATGCCATTT ACCAGATGGT GGGGAATACC GTGGAGCTCC 481 CAGAGGAGGA GAACACTCCT GAGAAGAGGG TGGACCGGAT CTTTGCCATG ATGGATAAGA 541 ATGCCGACGG GAAGCTGACC CTGCAGGAGT TCCAGGAGGG GTCCAAGGCA GACCCGTCCA 601 TTGTGCAGGC GCTGTCCCTC TACGACGGGC TGGTATACCC AACTTTCTTG TACAAAGTGG 661 TTGATATCGG TAAGCCTATC CCTAACCCTC TCCTCGGTCT CGATTCTACG TAGTAATGAA 721 CTAGTCCGTA ACTTGAAAGT ATTTCGATTT CTTGGCTTTA TATATCTTGT GGAAAGGACG 781 ATAAAGTTAA TAGTGATTTC TTATAACGCG TTAAGTCgac aatcaacctc tggattacaa 841 aatttgtgaa agatt